CR00278

CRIMIC CR00278

Gene Ocrl

CG3573

Information

Donor HA-L PCR HA-R PCR Stock number
pTGEM short band short bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
CGAAGACGTGAGTGTGATTTAGG

Amplicon 5' Amplicon 3'
ACAAGAGTCGCCCGGAAAATAATTGGAAATAAATAATGATCGCAGCGCGGTAATTAGCACGCGTGCCACTCTGTCTGTGCTGTGTGTACTAACACCCACCTCTCCCGCGCCCCATCAGCCGGCCGAGCCTAGTAAGATCGCGCTGGATTGCCAATAATTGTCATCGCATTGCCGATGAATAAGTGCCCCTGGGCGCGAGTGTGTGCGTGTGCGTGTGTGTGCGATACACCCACCTTGATGGAGGCAACAACAACAACAACACAGCAAGCGAGAAAACAAACAAACGGCTGCGATAAGCACTGAACACGATTCCACAACTCAACTGCTCTTCCGCCACGGTCGCGCTGCCCAAGAGCAGGGTCACCCCCCGGCCAGTTGCAGTGACGCCCTCGCCACCAGAAACCAAGCAGCCAGCTCCCAGTCCAGCGAAGACCCGAAGAATTCCCATTCGCAGGCGACCCCGCAGCAGACGAAGACAAGTCACTGGGCGTTCGCGCCAACTATAAATAGAAAAGAGCAACGACGCAAACAAGCAAACTGTCCATACAGCCCATATCCATATCTACACGCACATTTATCGACGCAGAAGAAAAACCCCTCAAGTACTGCCCTTCATTCAGCGATTAGCGCAGCCATCTCTTCGCAAACAGGCGGCGGAGGAGAATCCGACTTGGCGGGGAAAGCGAAGCGCACTCGAAAACCCTATCAGTACTCAGAATCCGGAGACAAATGGACACGTTGAGCGAGGCAGTGGCCAATGGAACCGCGACTGCGGCCACCAGGACGACCAAGGACATTGTCAAGGAGCGCTTCAAGGAGGACGAGACCATAGAATACGTAAGCAATCATCAGATCTGGCGAATCAAAGCAGGCGAAGGTTTAGAAAGGAGTGTTGGTCAATCATGATTGACTTTTAAAGTATAATGACGAATATTAGCAGGAAACATGCTAAATACACTAAAATGATGATTAATTATCGCTAACAAGTAACCTTACGCC ACACTCACGTCTTCGCTCAGAAAAAAACCTAAAACGGCTGCTATTAAACAATCCTTTGCTTATAGATATTCGAGGCGTATCAGATCAAAGGACCAGAGTACTCCAACCGTCTTCTGGCCCTGGTTTCATCGCAGTCGGGCGGCACGTTTGCCATCATCGCGTTCTCCTACTTGCGCACTCCATTGTCCTCCGCGAACGAGCTGATCATCAACAAGGTGTTCGCAATCGACCACAATTTCCAGTTGCGACAGGGTGAGATGAAGGGTGCATGTTCATCACACAGCTTGACTATGCTAGCCAAACAAATTGCCCAGTAACTGTTTGTCAAGTAGTCACAAAACCAATAAGTTTGCGCTCATTATTGGCCATAACAGATTACGACTGCATTTACTTATGATAATATTGGTATCTCAAATAGTTTCAGCTGAGATGAAAGCAAACTAATTAGTGAAAGCTCGCTCTTTTTCATATATCATTTTCCAAATTTTTTGCAGACAGCAAGAGCTCGATCACCACGCAACAGTTTGACCTG


Search Again