CR00278

CRIMIC CR00278

Gene Ocrl

CG3573

Information

Donor Location Cytology FBti Stock number
pTGEMX:1924027..19240342B16FBti020694483167

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
short band short band TAATTGCATCATCCTGCCAGCTGCCG TGTCCATCATCTTATCGCTGCGGGA

Images

Construct Design Sequences

sgRNA sequence CGAAGACGTGAGTGTGATTTAGG
 

Search Again