CR00277

CRIMIC CR00277

Gene ND-51

CG9140

Information

Donor Location Cytology FBti Stock number
pTGEM2L:6062583..606258326B4FBti020694383166

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
short band OK AATAGCTGCAAAGCGCGCTGCCGAA ATCTCCCACAGCATATCGATCTCAGCG

Images

Construct Design Sequences

sgRNA sequence TGTCATTAGCTTGTTTCGTAAGG
 

Search Again