CR00277

CRIMIC CR00277

Gene ND-51

CG9140

Information

Donor HA-L PCR HA-R PCR Stock number
pTGEM short band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
TGTCATTAGCTTGTTTCGTAAGG

Amplicon 5' Amplicon 3'
TCTCCACATTGGTAACTGTGGTTGGGCAACCGAACACACCCACATCAGCTGGGAATGGCGGCTTCAAGCGTGGCTTTCCCTGCTTTCCTTCCAGCGATTCGATCAGAGCGGTCTCCTCGCCGCAAATGTAAGCTCCAGCGCCGCGGTGCATGAAGACGTCGAAGTCGTAGCCTGTTCCGCACGCATTCTTTCCAATCAGACCAGCCTGGTAGGCCTCGGCAATGGCCAGTTGCATGTTGGAAGCCTCGTTGTAGAACTCGCCACGAATGTAGATGTAGGCAGCCTGGGCGCCCATGGCGCGTCCGGCAATCAGACAGCCCTCCACCAGCTTGTGTGGATCGTGGCGCATGATCTCGCGATCCTTGCAGGTGCCAGGCTCTCCTGCAAAGGAATACCAAAATCAAATATTGGTCTTGGAACGCACGGACAATTCCTCACCCTCATCGGCATTCACCACCAAGTACTTGGGGCGTCCATCTCCGGGCTTGTTCATGAAGGACCACTTCATACCGCTGGGGAAGCCAGCTCCTCCACGTCCGCGCAGGCCGGACGTCTTGATCTCGTTAACGATCCAGTCTGCCCCCTTCAGCACAATCTCCTTGGTTTTGTACCAGTCGCCGCGCTTCAAAGCTCCCTTCAGCCTCCAGTCATGTCGTCCATAGAGGTTGGTGAAGATGCGATCTTCGTCCGCCAGCGGACCGAATTTGGTCTTCGTCTGTGGCGGAGGAGTGCCCGGAGGTGGGGCCTGGGTGCTCTGGAAGCGCTGCACATGCAGGCTGGCCGGCAAAGTCGCAACTGCAAGACACATTCAGAGTAGATCAATAAATTGCGCAGAACACTGGACACTTTTGTTTTGCTTTGCGCAAAAATTACATAATTTGATGGCATGGAAATTGTTTGTTTTTAAGGCATGGGGAGCTTATGGCAATGGCATGATC TGATCCTTACGAAACAAGCTAATGACACTGTTAGAAAACTGGTTTATGGTTAGGTGGCGTTTATTTACCAATCTGCGGCTTTGTTAACAAATTAAATCGCACAATTGCAGCCATTTTCGGGACAACTGACTGACAGCTGAAATGTGACGTTTGTACGCAGCGCTGCCAGATGGTCCGAATAATTAATAGTGCAGATTAATCAGGGGCTTTCGAGCACGTAATCAGCTGTAATTAATAAATTGTTTCATTTTAAACAATGAATTAAAAATGTCTTACTTATTAAACACAACGGAAACCATTAAAACCATTTTAAAATGTTTTGAGCCAATGTGATGTTTCTTTCACAACTAAGCAGCCCTGGTGTAAACGGGGCTCAAGTTCAAAGCCAAAATCAAAGCAACAGTAAATACGTCCACACTGTATACTCTACTATTTGTTTAGTTAGAAAAATGGCCCATAAGCAGAGCACGAACAATGAGACATCCAATGGCTCGACAACTGAAATAATTGACGAAACCGATGCCCGTGCTCAATTGGAATCGGGCCGGACCACACCCACTCTTCTGTTGCGCCTCGAACATCCGCGGAATGAACGCCGGGTGGCCTTTCACGCTGGGATCATCGACAACGAGCATTTGAATCGCAAGAAGTCCAAATGTAAGCATTGATTGTTTCATCGAAGGACCAGACTGATTTCCTCCCATTTCAGGCTGCTGCATTTACAAAAAACCTCTCGCGTTCGGCGAGAGCTCCTCTGAGGATGACGAAGACTGTGAGCACTGCTTTGGACATCCGGAAAAGCGTCAGAGAAACGCAAAACACAATCACAATCACGGGGACAAACCATGCACGGAGGCGTCGCATCCGGAAGGACCTTCGACATCAACGCAGGCCGCGCACATCAGTCAACCGCCAGCCGAGCCTGTTGAATCGAAGACCGATCCAAAACCACCTACCCCAGGTGTTGACTTTGAGCAGACGGGCAGCTCGTAGAATGTATATATATAATTATAAACGTTAACAACATGGAACCAACTAGCAAGCACTCAGATCTACAAAGACGGTGTTTTTAGGCAGTAAGAACCACTTGGGGATTTGAAATCGTATGCAGTCATTAGTTTTTCGGCTTCAACTCAAAGGATTCGCTGACGTTAATGGGGATAT


Search Again