CR00276

CRIMIC CR00276

Gene TMEM216

CG8116

Information

Donor HA-L PCR HA-R PCR Stock number
pTGEM OK no bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
GGTAGGGGGATGGCATGAAATGG

Amplicon 5' Amplicon 3'
GCAGGTATCACTCACCACGTACCGCCCAAAGGTCCCAATGCTGGCGTAGAGAAGCCGAAACACCTGCTGCTGCCAGTGGAAAAGCGGGAGGAGCTGCTCCAAACTGCCCAGGTGACATCCAATCATTTAGAGGCGACGCACCTGCCGCCTTGAGGAACTGGTCGCCACGCAGGAGGACACGGATACGGCAACGGTTACGGACTCGTTTCCGCAGTAGCGGGCACCATGAACGCCAGCCTCATCTATGAGATACTTATGTATCTGAACTCGTTCTACTTTGGCATGTACGCCGCCTTCGAAGTGGGCGTGGGCGTTCTTAAGGCGATTAATCTAAACTACGGCGAGAACGCGTTGTCCCGGGAGGCCAGCATCCTGCTCTCACTGTGCATCATCGAGACCGTGCGCATTGTCTTCGGGCGGAAGAGCAGTCTAAGCGATCGTGGTGAGTAATCCCCATGATCCCCATGTTACTGCAAGGGTGGGAAAAGTCCACCGGCAGCGATGATGACATGGCGAAATTATTTGTTTGCCCGGTCACAATGCC CCTACCTCCGGGGCCATAACCCATAAACGTTTGGACGGGCATACATACATATATGTATGATGTAGCCCACTCGGCGTATGCGTAATTATGGTCATCACCCCGGATGAAAACACGCGTTTTATGGTGGCAGGGGAAAGGCGCCCTTCTGGCACATTAAGCAATATGCAAAGGAAATCTATCAAAGCGAATCATCGAAATGAGTTATTGGAAAAGCAATTGGAGCTGTTAATATTAATTATCGCAATGTGTAAACATGAAATTATTAGTATAATACTTTAAAACACTGAATCACTTTCAATCGAATACACTTAATTATAAACAAGTAGACGAACTATACGATTTTCCGTGCATCTGTAGCTAACATTTTCCTTGTTTTTCTCTCTTTGCAGGCTGGCAAGCAACCGCATCCGTAATATTAACACTGCCCAGTCTTGCTATTGTTATCTACTTGTGTTGTTTTCAAACCTTTGTTCTCAAACTCGAAATTATTCTGAGTGCCTTAATGATCACCCTACAAGGTGCTGAACTAGTCTACGCCAGCATATTCATTTGTACAATGTGTCGCCCCGTCACATACACCTAGC


Search Again