CR00276

CRIMIC CR00276

Gene TMEM216

CG8116

Information

Donor Location Cytology FBti Stock number
pTGEM3R:8717443..871746085A8FBti020694283165

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK no band GCCACATTTGTGCATGTGCGTTTGAG AACGCCACAAAGGCCGGGCAAAAGAAT

Images

Construct Design Sequences

sgRNA sequence GGTAGGGGGATGGCATGAAATGG
 

Search Again