CR00275

CRIMIC CR00275

Gene CG5921

CG5921

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK short band79230

Images

Construct Sequences

sgRNA sequence
CGATTAGATAAGGCCATTGAGGG

Amplicon 5' Amplicon 3'
GCTGGAAGACCCCTCGAATCTCGCTGGAATCCCCCCTTGCCATCTTAAGACAGCCATTCCCAGCCCATTGTTGATTGCTGATATTACCCAACCGAGCAGCAACTCAAGTAGCTGGCCACTTGTGGAGCTAGCATTTGAAGGGGGGGAGGCTCCATTATAATGAATTGCGGGGGTCCCCACTCGGCGATGGCATCTTATCGGGCAAATCGATAAGCGCCGCGACAGCAGTCTCTTCAGATTGCATTGGCCATATAACAGAGCTATATGTATGTATGTGACGGTGATTAGGATCAGTGACCAAATGGTCATTTCGAATTGTTGCACCCATTTGTTAGTTGAATTGGCCATAAATTGGGAATTGGCTAATTGACTGTTGATAAGGTGCTTGATAAAAGTTTTGGCAGTCGATGAATTATAGCTTCTGTCTGTAGGGTCCATACAAATCTGCATATTATTGTAGTATTAAGTGATTGCATATTTAAACGGCAATTAGAACACGCAATCGCAGTCATCGTAATTTTAATGGATGACGGGACACTTGCAGTTCCGCGAAAATCAATCAAATATTTGCCTTTGCCCAATGGCAGGCACTTCAATTGTTATCGATGGCTCTTCAGCGGACATGGAGAGCCGCGATTCCTGGCCAATTTTGGACAGAGTTCCGCACTCAGCCAAATGGGCAGATGACTCACGGTGTGGGTGACAAGCAAAAGAGAGAGCATGTCAGAGAAACCCAAACAAAATCGGGCAAACAAATGGCCAAGAGCAAACAGGTGGGGTGAATGGGTATATTTTGGGGCTGACTGTTCAGTCAGTGACTACCCC GAGACGTCGGCCGATGAACGATGAACCAAACTGCGCCGCCGAAGTTGTCCAGTCTTGGCAAGAGCTCGCTGGCGGATAGATCGCTTTACGGCCGGGAAATGAGTTTGCTGCGCGTGAAAAACGGTGGATCGGGTGGCGGGGAGGGGTCGGGTGTTATGCCCACCATGCGACCCGTTAGCATGGGCCGTCCCCTGGTGACCATGTCCACCTACCAGGTATTTTCAGGGAAAAATATTTACTTTTAGTGGTTGATCTAATGCTAATCTGGGTTTTTTCCCCTGGCATTTTTTTTTTTTGTTTTGCAGGAGCGCGGCGAAACGCTGAAACGCACCTCGATTATGCCCGACGAGAGCTGTTATCGGAATAGTATCAATAGTAACAACAACAATGGCTTCAGCAGGAACAGGAGCAACAGCAATACAAACAACAACAATCGCCTGCAGTCCCAGAACGGAGTGAATCCGGCGAATGGCAATGGGTCGCCGGAACTGCCGCCACCGGTAAGCGAATGATCCG


Search Again