CR00274

CRIMIC CR00274

Gene babo

CG8224

Information

Donor HA-L PCR HA-R PCR Stock number
pTGEM OK OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
TGTGCCCGGCCAGGTGCCCCGGG

Amplicon 5' Amplicon 3'
TACATTGCTCAGCCTAGCGCGAAAAAGCCAGAAAGTAAGTTCCGATTGCCTAACGAGAGTGTAGAGCACACTGCGGACAATGCACCCCGAATTATCTAAACAACAAGAATGTGATAGATTTACAGACTTGTTCCGGTATTGCCTTGCAAACATTTTACTTGACTTCAGTTAACCAGGAAAGTCAGCACAGAGTAAAGGTCATTTTACTTCCCTTTTTTAAGGTGAAATCCATTATTGGGAGAAGATAGAAACCGCTTAGTGGTTATACCTTACTTGTCCGATATATTGACATTTTTGTTGTTGTTGTTTAATAATTAAAATATCTTACCAAGGGTTACTTAATACTTGGCGATCTTTTCGATGCCATAGGGATCTTTTCTCCGTGTGTATATCGCGTGACTGTAACACCTCAAAGACTCTGAACGCTTCTAAAAGGCCGTCTTCGTCTGCGCCTGAGGCTCCGATTCCGTTCCCATATAGTGACGTCACCTCTCCGTGGTGTCAATGAGCTGAGCCAGACAGCTCTCATGGCCCACTCCAACGCTGCCTGGCTGCAGACACCCCCACGTCTGGATGCATTTGCTTGCTGCACTTGGGCACTTGCAACTGCAGTCGGTGCAAAAAAAAGCAGGCCTAAGCACTGGCACTGGCTTCTCGCTGTCCGGGGGAAGGGGAAACTGGTCGCATTGTCTGGCCCTCCACTTTGCACTTGTCTTCTCCGCGTCTGCTTTGTTAATGCTAAATGGTTTTGTTTTTGTTTCATCACGCTCTCGGCGGTGTCGGTGGCGGTAGATGTGGATATGGTAGTGGCTATGGATGTCTATGTGACTGTCTGGGCGAG GCATGGTTATGGCAAATCCCAATTTGTGGTCAGGAGATGCCAATCAGCGAGTGGTTGATTTATGGGTCTCTTATTTCTCTAATTAGTTAATTTCTGCCAGCGCCTAATTGATTGATTTGCTTCAATCGGAGTCGGGGCATTTTCTTAATTCGAGAAGTTTGCTACTGCTAACCTATGCTTTTGCGTTTTATTTGTTTAAATAATAAGAAAATCATTAACCGTGGCAAATGAGGCGCGGACCTCTTCCTTTGCTTACCTTTCCACAAGTAATTAATATTCATTAAATATTACAAGAAACACGTGCTTGGTTAGGATCACCTACAAATAGTGAAGATATATCGTTAAGCGAAGAATAAGTTTTTGTTGGTGAGTCGGTTTAAAGTTAACAAATTTTTGGTAGGAATGTATGGATTTGATAGTACTCTAAAGTTTGGTTTTTTGCAAATAGATCTTTATATTAATTTTACCTTTTATGTTCTGCAGACAAGATAAAATGCCACTGTGACACGTGCAAGGAATCGAACAATATATGTGAAACGGACGGCTTTTGTTTCACGTCCGTGGAGAAGAACTCTGATGGGAGCATCATCTTCAGCTACAGGTGAGTGCCGAGAGCCTGAGGAGCAGGCCTTTGATTAGGTTAGCACTTGCCCCTCAGAGCAGCCAGTGTGAATATGTCTGATACGATCGATCTATCGAGCGATGCAGATGTCTGCACAAGTCTCAAATCTTTCCGCCGGGCCGCTCCATCTGGTGTAACGACGGG


Search Again