CR00273

CRIMIC CR00273

Gene alpha-Spec

CG1977

Information

Donor HA-L PCR HA-R PCR Stock number
pTGEM OK short bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
ATATACACTCAGATCGGGATCGG

Amplicon 5' Amplicon 3'
GTGCCTGGATCTGTTGCTCTAAGTTGTGCTGCATGCGCATAGACAGCTGGTCAAGCTGATCCCACTGCTGGGCCAGGCCCACCGTCGAGTGTTCCGTGTAGCGGTTGTCCAGAATAAGGTGCTCCTCCAGCAAGGCTCCCAGCTCCTCGATCTTCTTGAGGTCAACGCGACGTGCGCGCACCTCGGTGGCCTTGACACGAAGCGCCTCCAGTTGCTGTTCCAGGGAACCGGAGCCTTCCATCATGGACGTTCTGCGAAATTCGCGATGTGGGGATTGGTTGAGAGTTGGCGGATAAAAAGCGTCTATTAGTAGGGCACAATATCGAGTTAGGTCTCAAACAAATCGGAACGTTACAATGATATAATGCAATAAGAGAAGCAAATCTTGTTAGAGGGTCTGTTAAGGGCAGCGAATATTTTTCTGGATTTTCTGAATTCGGGCTTGCAACTAGTTTGTCTTCACTTTGTTTTTAGTTTGTACATATTTACACGTGTCGGTGGGAATTTGGCGGGCCCGAGTGTTTTATCTGTTTGGGTCAGGTTTAGTGTAGTTAAGATTGGTTTTTTGTTGAGTTCAGCAACTAATAATGACGAAAGTTGTCTAATTGCTAAAAGCGAGTTAAAATAAGAAAAGCGCCAAAGGAACGTTTAAATTGTAATTTAATAATGCTACTAGATTTGGTTAAACTCTTCGATTGAACGGAATAAATATGAACATAATTTATGTTTTCGATTGCTACATATTTCTGTATGCTACAACAGTATTTTGATCTCGATTCGCATGCTAAAGAGTTCAGTTTCGTTAATTTTGAATAAGATTAGGTGAGACCAAAGGAGTAATGGAGAATCGAAACAGTACGTTGACGA TGGGTCAGTGCTCTCGCTAATGCAACTAACTAAAACTAGGTCTTAGTCGTCGCTCAATCTTATCAGTGTGGATATATACGAGTATTTACAAGCCCTCAGCTCAAAGGGCAAAGCAAGAGTTACGGAGAACATGGCCATTCCAAAAGGTTAGTGGAGGCGCAGCGAGATTGGGAGCTCAGCCCCAACGCGAGTTAAGAAACCAAAAAGATCACAACAGAAAATAAGAGTTCAAACGCAGAATCAAGCCTGCTCGCTTAATTACCCTTGACGGTTATAACCCAGCATATAATATCTAGAAAATAGAATGGATCTTTCAGTTACGTAGTATTTCATGGGGTTAGAGTCGCGACCACGAGACTTGTTTTCGGATTTGTGTGGATTGGGATGGGAACATGGATTCGATCCGAAAAAAACCAACACACGTCTGGATGGAGTAGCCCACATTTGGGAAAGCCTTAGCCCCCACTCACCTTGTCTCTGTTAGCCACTGGTGGAAAAGATTGGCGTGCTTGGCAAACTCCTTGCGCAGCTTGTCGTTCTCCTCCTGCCGCTTGGCCTCCTTGGCAAGTTCCCCATCGCGTTCCTCTATGATCTTTTGCAGATTACGCCAGGTCTCCTCAAGAGCTTCCATGGTGAACCACGTGTACGGGTTGGGTCCAACATTAAAGCTCTTGATCTTCTGGTCGAGTGCTGCCAATGCCTTGAAGTCAGCTTCGGCCGACGAAAGGGACGCCTGGAATTGGGCATGGGCGTCGCGCAGGGCGCGGATTTCTTCGATCGAATTGCAGCGAACAGGATCTGT


Search Again