CR00273

CRIMIC CR00273

Gene alpha-Spec

CG1977

Information

Donor Location Cytology FBti Stock number
pTGEM3L:1780601..178062562B4FBti020694083163

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK short band TGGACAACTCGGCCTATCTGCAGTTCAT TTAGTTCTGGAACAGCGTTCGCGTGAAG

Images

Construct Design Sequences

sgRNA sequence ATATACACTCAGATCGGGATCGG
 

Search Again