CR00268

CRIMIC CR00268

Gene shf

CG3135

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 OK OK78886

Images

Construct Sequences

sgRNA sequence
AGCCTAGATCTTCTTCGAGATGG

Amplicon 5' Amplicon 3'
TCGTTCTTGCAGGGGATCACACACTTGGCTGTGAGGGAAATGGGTGGGCAAAGGTTCAGTGTTTCGCCTCGATAAGAGTTGAGCCGTTTGCTACTCACAGTACTCGCAACGCAGGCCGTAGTAACCCTTGGAGCACTGGCACTTGTCCTTCTGTATACACTTGCCGCCATTCAAGCACTTGTCCTTGCAAATACCTGTTGATTACAATGGGATACTATTAGTTGCGCGCCAGGCACATTTCATTCTTATATAATGCCCAGTTATCTTGCCCCAAGTGTACTTAATCATCGCGTATCGTATCACCCTCCTTTTCTACGCAGATGGAATGCTGAGAAGAGGTCTTAGCCGGCCCGAGCCACGCCTGCTCTCCAAGCGCTATCTAAGCTCAGCAACTGGAGGAGGATCAGCAGGCACGACCGAAGGAGGCAGCTCTGAAACCACCCCGCTGCGTCCACGTCCAAATGCGCTCACAGATGAGATTATACGCGTCGATCATGCCGGCGAATTGGGAGCAGATCGCATTTACGCCGGGCAAATGGCCATTCTGGGCAACGGACCGCTGGGCAAGACCATCGGACACATGTGGGAGCAGGAGAAAGAGCATCGTAAACAGTTCGAGCAGCTCATTCAACAGCACCGCGTGCGTCCAACGATCATGACGCCAATTTGGAACGTGGCCGGATTTGTGCTGGGCGCCGGAACCGCCCTCATGGGCGAAAAGGCAGCCATGGCCTGCACGGTGGCAGTGGAGACGGTGATCGTAGAACACTACAATGACCAGCTGCGTCAGATAATGGAGGCACCGAACCCGGATAAGGTAAGTACCATTTGCAACTGCCCCAAGCAACGGACGAAGTAACAACGTTATATGATTTTGCAGGAGCTGTTGGCCACCATCACCAAGTTCCGGGACGAGGAGCAGGAGCACCACGACACGGGCATTGATCACGGTGCCGAGCAAGCGCCCTTTTACCAGGCCATGACCGAGGTAATCAAGTTTGGCTGCAAGACGGCTATTGC ACAGTTGGGCCCCCTGTATATATCAAAATCAAATTATCTGTTCCGCTAAGCTAACCGTGTTAAGCATTAAAGATAGAGCTAAATGTCCATAATAGTCGCGTCTACTTACCACCTTCGCACTGCGTGCCCTGGTAGCCCTCCGGACAGGTGCAGACGGACGGCGCCGTGCAGTTACCGCCATTGAGACACTGCGGAAAACAGAAGGCCGTCTCGCAGTATTGGCCCGTGTAGCCCACGTTGCACTTGCAGATGTGGTGCTCGTTGCAGTACCCGTTCTTGCCGCACTTCAAGCTGCATTCTGGATCGGGAGCTTAAGTTTTTTTAGTTTAGTTCAATCGTTCGCATGTCACGAGGCATAAACACTCATTTTAACACTCATTTGGACTCACACTTAACGGAGCACATCGGAAGCACAAAGAGGGGCAGGTTCGAGTAGACAGTGGATACATAGATCATAGATAGATAGATACAAAAGCGGTTGGCGTGGGAGCAAAGGGTAGATCGTATCGAATTATATATTTTTTGCGGGCTATCAATCAATAATTTACTATCGAAAAATTTGGAACAAATTTGAAGAATTTTCGAATTCAAGAATGAATGCAATTAAATTTACAATTTCATATAACATATCTCATAAAGGCTATATAGTTCCTTGTGACTTGAATATGTGATAATGTCATTAGGTAGTTACTTTCGCCAGATTCTCTTTGATAGCCCGAGTAATTTAGTGCTGTGGAAAGAGTGAAGAGCTGGGTGCAGGGGACTCGTGAAAAGCGACTACGTGGGGTAATGGAATCGG


Search Again