CR00267

CRIMIC CR00267

Gene Acon

CG9244

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 no band short bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
CGTATTCAGTATACATGTTTGGG

Amplicon 5' Amplicon 3'
TGTGGGAAAGTATCACCCGCCCACGCAAACAAATGGGCAGTGTTGGACAGCACAGCGCGGTAGTCGTCTGCGCTGGCTGCTAAAAAAAAGCTAAAGGATAAATTAATCCAAGTCCCTGCTCAGAAAAATAAGTTGTCGTCAGTGCATTATTTCAGCATTTACTTCGATTTAAGTTTTAACGCCATAGAGTCCATTAATTCTCTTGAAGTTAATAAATGTTTATCGCTTTAATTCAAAACTGATAAACTTTCTATGGTCCTATTTATTTAACGACCCAATTTTGGCGGGAAACAAGCCGGCGGAACATTGCTGACGCGTATGCGTGACGCCAGCTAACACTGGTCGCCGTGGTAAAGAATTTAGTCTGTCTTAAAATCTTCCGGCTGAGAGGGCTGAAAATTTTGACGGCTTCGAAGCATTTGCTGCAATATCAATTTCGTCGGGTTTATTTCGAGTATCGCTTAATCAGGACGCGACCATGGCTGCGAGATTGATGAACGCCCAGGCACAGGTAGGTTCTAGAGCGGAGCCTGTGCCTCCAGTCGGCCAATATATAACCACGGCTATATATACGTTTACGTATAGAATCTGTGAATGGAACCCCGAAATTCCAAGCTGCGATAAAGACAACTGGACAGAGCACTGCGCGAAAGTTTACAAAAAATCATTGCCCATTTCTTACACACCCAGCAGGATGTGGGCAGCGAAAAATAGCAAATTTTTCGCACAGCGTTTTCTAACCTAAAATCATAAAATTCGAAGTGGTTAGGTAACCGAGTTCGCAGTGTTTGTGATTCTACAGGCCCTGC CAGCAGTGAACCATGCGAAATCGTTAGCTCTCAACAATTAACAGCGATTCGTGGGGGTTCGATGGTTGGCATAGTTGCATTTACATAATCGCCGGGGTCCAGTTATTTAACCAGGAGGCGAACACCCTCTAGAGCATATATCTTGTGGCGGAGGACCGTCTTATCTGTGACAGGTTTACTTACACTTTGATAATGCCAGCACTAAATATAGCTTAAAAAAGTTGCGCCGTTTAACTTGAGTATCACGCGCATTGGAGGAGTTTTGCCTTTCAAGTGGGGTTTTTCCACGTCAGCTTCGAGAAAGGTTTCACTGTACTCTGCCCATAAGTTAACGACCTATTTGACGTAATTGTCATTGCAATTGTTTCGATTTGCGTGTATGTACATACAGTCGTGTCGTCACGTGGTTCTTCTAATTGGAGTGTTCTGTAGAATATTGTAACAATTTGAAAGGCTTACAAACAAACTATATTTCCAGCTACTTTTTATTTTTTTATTCTGCAGTTCGAAGAACCTTAAAGCACTTTGGCTAGCACTTAAAATACTTTGATTGTTAAATGTAAACTTTCAATCATTTTACTAATCTCAAAAAAATATTTGGAAAAATTTCACTCTGAAGCGGTAAATGGATCAATGGATTATTTTTGGCTATTCAAAAATTTCAAGACGATTAAAATTTATTAGCTTTAGCAATATATTGATCTTAAAACAAGTGAAAGCGGTGATAATAATGTTTTACATTTGTTATATATGTATGCAAGATTAAATGTACAGTAAAGAAGAATTTTCACAGATATGGTCCCCACATGATTGTACTCTTGTCAGAATATCTTTGGGAATTATCATTTCCTGATAGAGGAATCAATTTAATTAAAGTGACGAGGACTCGTCCTCTTGACATGATAATCAAGTGTTTATTGGGCTACCAAGCGAATAAATAAAATCTCACAGTGTGCGAAGTGCAAATAAACTAGAGAATCACATTGTGTTAATTACTTGATCTTGATTGCTAAATGTACCACTTCACCATATTTAACAGTTCGACTTCTTATCTGCTTTCCAGGTGTGTCGACTGGGCAAGCATGTTGCGTCCGAAGCCACAGTGGTGCGTCAGTTCCACGCCTCCTGCTACACCGCCTCCAAAGTGGCTCTGTCCAAGTTCGACTCGGACGTCT


Search Again