CR00265

CRIMIC CR00265

Gene parvin

CG32528

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 OK OK78885

Images

Construct Sequences

sgRNA sequence
AGTGGCCCAAAATGACCCAATGG

Amplicon 5' Amplicon 3'
GCCTCGAGTATTCGGAGGTCTTCTCGCCGATCTTCGTTCTGTTGCAGCTCGTGGCTGTGCGCGCCTGCCAGTTGCCCAACTCCATCTAAACCATAGACGTAGTATAGCCCTAGTTCCGTATTATACATATATGTAACTATTCTGAAAGCCTTTAAATCATTGGATTGGTAGTTATCTGTATACGCAATGTGGTACAATAATTTTTAAGCGGTACGAAATTTATCTTTCTGGATATAGCATATCTAATATATACGAATTATATCTGATCTGATTCGGTATGAAGGACATACATACATACATATGTTGTTGTGCTTTTTAATCAATGATCTAATGATCTACGCATTATAATTTTTTTAAAATTTCCAACAATTTAATTTGATGTACAAATTCAAAAACTATTAAGCTGATATGAATTTCTTCTAGCTGTTGTTGTCAAAAGCCACATTTTTTTTAAATTATAAATGAAAAATAACATTTAAGCTCATTGTTTTAATTTAATCTAAGGTCTTTTTAAACAATTTTTATAATTGGCAATTTAGTTTTTATTCGATTTTTTTGGAAGTTTCTCTTGAGTCCGAACGCCAGTGTTGGACAACATGTGTGGTGGGCCTGCGATCAGGTGGCAGCCCCAAGGGAAACTGATTGCTCAGCTCCGCCCGAAACGAATCGAAACAATAACACAAACTGTTCACTTAGTCCGGAATTCTTGGAATCCAGCAGCACCATGTCCACACTGAACCGCCCTAAATCCCCGCACACGCCCACCGCCATTAAAAAGGGCGAGAAGGAGGACAGCTTCTGGGACAAGTTCAGCACTTTGGGCCGCAAACGCGGCACCCGCGAAGGTAAGTCCACTTGATGATTGGAGCTCTCCAGATGGCTATTGTCGGCCAGGAATTGATGGGTATCCCAGAGTATTCCATTCTTGGACCCCTGAACCTCCGAAAAGTGGCC ATGGATCCTCCCCCTGCGCACTGGAAGCTCTTCTGGGAACAGATGTGCGGATGCGCTGATTAATCAGAACATTGCGTCACTGTTGACCCACACAAGCAAACGGCGCTGATAATCGAGAGTGTGTGCGTTTGTGTGAGATGGCCTTGTGTCGTCACCGTTTTTGTTTACCTTGTTGATACCCTAAATACGCATCCGCTTGCTCCATTTGCAGTGAAGAAGGTCCAAGAGGAGGGCAAGTACGCCATCGACTCGCCTGGATCGCCCAGCCAGTATGACATCCCGCCGGAGGACTATGCCCTGCGTAAGTGCATTCGTTTTGAAGGGGCATCTCCTCGTATACCCATCGCATTTCCCACAACTCATCACATTTGATCCTACAGGCGAGCACGAACAGCGCGCCGTCATCGATCCACAGTCCATCAGTGATCCCCAGGTGATAAAGCTGCAGCGCATCCTCGTCGACTGGATCAACGACGAGCTGGCCGAGCAGCGCATAATTGTTCAGCACCTGGAAGAGGACATGTATGACGGCCAGGTGCTGCACAAGCTGTGGGAGAAGCTCACCGGCAAGAAGCTGGACGTTCCTGAGGTCACCCAGTCAGAGCAGGGCCAGCACGAGAAGCTCAACATCGTCCTGAAGGCCGTCAACCATGTAAGTAGTAGTAGTTTATGTTTTGCAGGATTTAAAAATCGGAGTTACCAACATTTAATTATTTATCCATTCTTAAAGTCGAATAGAATAATTTTTATTCGATTTACAATTAACATTCCCTTTTCTCGCGATATAAGAATAAATTTTATCCTTGCCCACACCCACAGACACTCGGCTTTCACCAAAAGATTCCCAAGTGGTCGGTGGCCAGCGTGCACTCGAAGAACATTGTGGCCATATTACATCTGCTGGTGGCACTGGTGCGTCACTTCCGGGCGCCCGTTCGCCTGCCAGAGAACGTGTTCGTGACCGTCGTGATT


Search Again