CR00261

CRIMIC CR00261

Gene whd

CG12891

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 no band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
CATTGTGGGGAGACGGTTTGTGG

Amplicon 5' Amplicon 3'
GGCTTCGGATGGTCCTTCATGTGCTGCTCGAACATGCTGCGAATGTCTGACAGAGCCTGCGATATGTTCTGAGCGAAGCGGTGCACATCCTGTAAAGAAAACAATTCGATTAGCTGTGCTCCATGCCATGAATCAGGGCTCCTCATTACCGTTTGCTGGCACGTAGTCTTCGCTGAGATATGGAAGAATATCAGGTTCTCTCCGGCAATAATGTACGACACACCGTAACCATCATCGGCCACGGGCCCAAAGCCGCCTCCAGCGCTGATGCAGTTCGGATGCTTCTTCAGGTCCATCTTGGGCGTCTGGCCGTGCGGAGTCTGACTAGTAGAGAGGCGCCAGGGTTCGCTGAGCACCTCGTTGAGGAAGGGTGAATCCACCTCCAGGTACTTGGAGACCACATACAGGCAGAACAGATGCCTGTCGATGCCACGACCGCACATGGCATCCTGGTAGCCCAACTGGTGACGATCGCAGGCAGCCTGCATCATCTTCACACGCTCATCGTTCTGTACAGCATGGATATATGGATTAGCCTTTGATCTAATTACATAAAATTGTAAAATCTTACGGTTGTATTTGGGTTCTGCATGGCCTTGACCCAGGCGGATGACTCAATGGTGCACGGACGCACTGTCTCAGTTCTTCCTTCGCGGAACAGACGGGTCATTGAAGCCTCATATGTCAACGAGAAGCGACCGGCATCTCGGTAGTAGGCCAACTGCAGGGCCATTTGTATGTAGGCATCTGGTGAGATGCGGCACTTCTTCATAAAGCCCTTGCCGTAATCCTGGTGCACCAGGATGCGCAGATTGACCTCGTTGATAAGCTTCGTCACATCGATGGTGGCCTCTTCGATCTGCGCCAGGCATGGTTTAAGATCCCAAGTGAGCCTAGTGGGCGTGGGTGGCTGGAACGCCGGGGTGCCCTTTGTATTACCCGTTTCGTCATATCTACAGGGTTACCAAGGGAATAGGTTAGCATTGTGGGGAGACGG GGCAAATTTATGGCAAGCAACGTAAATCAAAGTATTGTTAATTTTGTGTAATTGTTGTTAGTCACGAAAACAAAATAAACTAAATGTTTACTTTTGGGTTGATTACAATTTGTAAATACAGTAAATAAAGACAGTAAGGAAAGTAAGGAAAAACAACTGAAATGGCCAACATAAGCTTATATAAAATATGCTGCGTACTGATCAAACTATTCCTCATGTAATAAATTAATAATCCCTTAAAACGTGTCTGGCATTCGCATACTAGATTTTGTATGTTTCAAGTTCGTTATGCTAGTATTTACTGTATGGCGAGATCATTAAAGCTTTTAGCGCCTAGTGATCTCTCGTACTCAACCCAAAAATGACTTGAATAACTTTGCTTTGTGCTTGTGTGCATTGTAGTTAAGTGTTTACCCATAAATATCATCACCAAATATATACTCCCACAGGTGTCCCAAAACCGGTGCATCGGCCCTATAAAAAAAGTGTAGATGGTGTAAATAAATTGTTAGGCCACAACCGGAGTTAATAAAAATAATAATAATTTTTGATTGGGACAATGGGTGATAGGTGATGATAACTAAACGCAGCCAACCGAAACCGAAAAATTGCAGGCGGTATAGGAATCGAAAATCATTACCCGTCCGATACAAGATCATCGACGATCAGGTTCTCCCAC


Search Again