CR00260

CRIMIC CR00260

Gene CG8079

CG8079

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 OK OK78884

Images

Construct Sequences

sgRNA sequence
TAGTCGTTACTCATCGTTCGAGG

Amplicon 5' Amplicon 3'
TCCCTTAGTCCAGCGTACCAGGATGCCCTCCTTAAGGCCTAGTTGCACGCAAGGGAAGGAAAAAGTGAAGCCCAGTGGCAGATATGCGGTCTTCATGTCGTGTTTCTCCACAAATTTGGCCAGGCAGCCCGCAATGTGATCGAATAGGTCCACACCGGGCCCCACCATCAGGTCCTTTGGCACGGCATAGATCTGAGAATCCACCGTGGCGTCGTGGTGACCTTTCAGCGAGACGAGCAGTACTCGGAAGTTGGTACCGCCGAGATCCAGGGCCAGGTACTTGCCCATCTCGTCGCCCGTGGGCAGATCCTGCACGTACGTGGGAAAACACTTGACGTTGGCCTGTGGATGCGTGGACCGCTTAAGTCCACGGGCCACTTCCAGGCAAAAGCGACTGTACACTTCCTGCACCTGGTAATCACTCAACACAAAGGGTTGCATAAGTTCTCGCACCTCCGCGTCCAGCATTTTGCTTGGCTAATCTATCTGTCTTAGTTGTAACCGCCTC ACGATGAGTAACGACTAACCAGGCGCCTGGCGAGCCCACGGCGATTTGGAGTTGCCCTGGGTGCCTGATAAGAGCCAGGCGTTGAGATGCAGTGCGCCTTGGAAACAACTGCTGCCGCTGCAATATGGGCGCTGCGTAGCAAATTAAAAACGAAAACACACCTAAGTAGCTGATTTGCGGATTCCGAATCTGAAACTACAACTGCGCGACATGCTAATCGCTCGTTGTCTCGTTTGCCGCTTGTCAATTGGTGGCAATAGCTTCAGATTCGGCACCCTACAAATTAATTGTAGATCGTCTTTAGCCGACTATTGGAAAGGAGGAAATATGTCACAATTAACTCTGCGAATAAATCCCGGATGGACACCGATCGCATGGCACAAGAATCCATTAAGAGATTACTATTAAAAAGTGTTTCAGTATCTACAAATAAGGTGTCCTCCGTTGTACTAAATTGTTGTATAACTTTTCGTAGAGTGCCATATTTCCGGAAAAAATGGCCAAGGCCGTATTTCACTTTTTTACTTTCTAAAAGCCATAAATTGTCACAGGGCGATATTAGCTGCAACACGCCTTCTTAGTTACGATGAGATAAGGCCGTTTCAAGGACCGCATCTTACAAGCGCAACCCACCCACTTGTCTATCTATTGAGGAGTATTGGCGGGGTCCTAGGTCGAGTACGT


Search Again