CR00258

CRIMIC CR00258

Gene CG5958

CG5958

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 no band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
GCCTTATCGCCAGCAAACATCGG

Amplicon 5' Amplicon 3'
GATCACACTGCCCTTCACGAATTTCTCCTTAACCTGCTCGACCAGGAGTCCGCGGACCAGAGAGGCGTACTCCTTGCGGAAGCTGGCTGTGGTTTTCATCTGAAAGTCATTTTCAAATTAGTCAAGAGCTTAGCAAACTTAAATTTATGTATTTTATGTGAGGATAAAAAATTTTAGTCTAGGCAACCAACTTAATTTAGCTTATTATGCTACTCGTGTAGCTAATTGAAAACTTTATATTTTTAATATTTTTATAGGGTACACATTATAAACAGAGGAATTGCCTCTATAAATCTTTGAACCGATGACGCTAACTTCTTACGGAACTAGTCATTGTAACTTCATCTGTTGGCAGGTGTGACATGGCTAGATTAGAGTCCATAATTGATAAGGTATTGACCATTGGCCAGAACTATAAAATGCCCATATAAGTTATGCGGCTTCCTATGATGATAAATTTAAAAATGGCGAACATTCGATTTTTATGACCCGATTCAGTCATTCTGCTAAAAAGTCATTGAACACTCTACATGCATAAAGTGAATCCGAATCGGATCGAAATCGACCACGCTTATCAGGGTTTTCTTTGCCGGTCAGCGAGTTCAGAAGCAATAAGTTATCAGCAGACGGGAACTGTAAATGATCCTGTTGTTGGGTTTCATTTCAGATCGTATGTTGCTTCTTTTACAATATCCCATATATTACTTTAGCTAGACTATAAATGAGGTGGCCATTTTCTGGGCAAGTTTTTATGCAACCGCTTAATCATATATTATTATGTAAGAGATATGTAGATAAGGCCATGGTTATAAGCTGATGCAACTTTCTAAACTTGGGGCAAAAATGCTTTTCTTGTAGCTCTTATGCATATACAATATTATTCCCCCACTATCTAGTGCACTTGTTTGAACTTCGGTTATAGACCCCATTTCAATAGCTCTGGTTGACCGA GCGATAAGGCGTGTTCGAGAAGTTCTATACATTTGATAATCCCTCAAATGTTGAAACAAATAGACGGAGACACTTGTGTTGCCGGCGTTGATAAGCAAAAAGCCATTGAATTGTGTTTCTAAGGCGGTCAATTCATAATATACATATATATACTATGTATGCTTGCGATTTGATTGAAGCTTCAGATGATTTTCAGAGTGATGTGTAATGTTAAGCGATTATTAGTATTATGAATTGAATATTGCTGGAACAATTTAGATATTCCTTAAACTATGTTCCTTTTTTTATCATCATTGGATTCTGGACTATGTTTAAATAACTTTAAATTTGTAATTTATATATATTAAGAACTTAACGTTTGGTTATATTGCATTATGTATTAGGGAAGTTAAATGATTCAAAACATGACATTTTATGATATTTATTAATGGTGAAGTTAAAATGAAAAGTGAAGGGCACACGAAACTGAGACACTTGCATTGCTGACTTAACATTGCATTATCAGTGGCTCGCGATATGCTTTCATGGTACGCACCTTTTCCAGAGCTCCTTCGGGATAAAAGTGGCAGGCGCGCAGGAAAACTGTGAGGAAAGCGTCGTCATCCTTGTAGTTCAGCTCGGGCGTGGCCTTGAGCAGTTCCCGTAGCTTG


Search Again