CR00253

CRIMIC CR00253

Gene lbk

CG8434

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 OK OK78883

Images

Construct Sequences

sgRNA sequence
AGGCCAAATGTCGATGTAGAGGG

Amplicon 5' Amplicon 3'
CACTATCCGCTGTCTGCCTCACATCCACCGGCTGGCGTTCAAGGATCCTCCTCCTCCTCCGGCATTTCCATACAATCCGGCTCGCTGGAGACAAATGGATTCGTGGCCGACGATGGTGGACAGTACGAGCATGCCCAGAAAGCACTGGAAGCTGCTGCTGCGGCAGCCAAGGCCAGTAATAAGTACAACATCGACTGCCCCAAGGACTGCAAGTGCCTCAATGTCCTCTTCGACTGCGATAAGCTGCATCTGGAACGGGTGCCCGTCTTGCCCAGCTACGTGCAAACTTTGTAAGTATATTGTTAATAGAGGAGGAAATTTCAGGCAGATCTTCATTTTTTTTTATTTTGATTGGAAAAACTATTTAATCAGCTTCACATTAACTTAAGGTCATTGTGGTTTTTCTTCTTCAAAAACTTCCAACTTCAGAAGAATAGCGAATATTGGTGGAGTTTGAAACATTCGACATTATTTAAATCCATAAATTCCTTGGGGGATGAAATGGCGAGCCACCCCCATCAGATATTCTCTGCGAATATAAATTACAGAGTGGCACAACCCT CATCGACATTTGGCCTCAATTTTAGCATTATTTTTTTTTTTTTTTGGGGGGGTTGCGATTTTATCGTTGCGCTTTTAATCAATTTAATGCATGGCAAAATTATGCAAACGTCGTTCGGTTTTTATCAGTAGCTTTGCATCGATAATTGCGACATAATTGAGTTGCATTGGGCTAGCCAAGGATTTTACAAATGGCGTAAATTAACTTTTATCTTTTTTTTGCAGGCATCTGGCTAACAACAAATTGAACGATACAACCGTTCTGGAGATACGTAATCTGTTGAATTTGACAAAAGTGTAAGTCAATCGAGAGTTTATCCGAGAATACTTTAAACTAATTACACTTTACATTTGCTTTTAGTTCATTAAAACGAAATTTATTGGAGGTAATCCCGAAATTCATTGGCCTCAGCGGTCTGAAGCACTTGGTATTGGCTAACAACCATATAACCAGCATCTCCAGCGAGTCGCTGGCAGCTTTGCCACTGCTGAGAACGTTGGATCTGTCCAGGAATAAGCTGCACACCATCGAGCTTAACTCTTTTCCGAAGTCAAATAACCTAGTTCACTTGTGAGTTACCTTGAATGTTCCTTGATTTAGGCAAATATTAATCCTTTTGCCCACAGAATACTCAGTTTTAACGAGATAACCAATGTGAATGAGCACTCGTTTGCGACTCTAAACAACCTAACAGATCTGGAGCTGAGTAATAATCGCCTAAGCACTCTGCCCATAAGGGTTTTCAAAAATCTGAATCAACTGAAGAAGCTGTAAGTTATTAAAATACTGCATTTTGAACAACCTTTACAATGTTTTGATTTCACTTTACCACAGAGCTCTCAACTTTAACCAACTGGAGATAAACTGGTCCACGTTCCGTGGCCTGGAGTCGATGAAAAATCTTCAATTGAAGTCCAATAAAATCCGTGCGCTGCAGGACGGCGTCTTCTATGTGA


Search Again