CR00251

CRIMIC CR00251

Gene GluRIA

CG8442

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 OK OK78882

Images

Construct Sequences

sgRNA sequence
AGACACGAGCTCGAGGTCGCAGG

Amplicon 5' Amplicon 3'
CAGTACTACGGCTGGCAGAGCATTATTTATCTCTACGACTCGCACGATGGTGAGTACACCAGTACCACACTCATACATTTGTATATGTATGTATACATTCCATCTTCCATTCCTTCACAACGAGATCCAAGCCACACATTATCTCCCCGACTTGTTTGTTTGCCCATTTGGTTGCTTTGTGTTTCGATTTCATTTCATTTGACTTTCATTTGCCATAAACAAATAAGGCCTCGAACGGCTGGGAGTGGATTTAAGTAGCGGTTATGGCAATGTTTTCGCTGGGGATTAAGTGTGTCAGTGCGAGGGTGGGATGTGGACTTATCTAGCACCGCTGAAAAGCGGTTATGGAATCTATTAAAAAATTTTGTTCTCCTATGAAAATACAAGTTTACATGTTTAATTTGTTTTAACTCGTCTTAAAGCCTCTGTAAGCAAATGGTGACTTTGGATTTCTCACCTCGCCATGTTAATTTTATCCATTTCCTTTTCTACTCGCTACCCCTGTTCCACTTT CTCGAGCTCGTGTCTCTTCATTTCTGCTAATATGTAATTAAATAAGCGGCACAAAGAGCCCCGTGCGCCTTCTGAAAAAAAAAGTAAGGAGGGTAGAGCTCGGCAGACAGGGCGCTCAAGTGCCTTTAAGAGCGCTCTTTCGAGTGGCTCCTCAACGGGCTTAAGCAGCCTGGAGAAGGACACACGCACACACAGACAGGCGGGTATATTCCACGCACACATATGTTCGAGCTTACCCGCTCTTTGTGCGTGTATGTGCATGTGTGTGTGTGTGTACATATATGCTTTGGTTCTTAGGCTGCTTTTTGTTGTATTGAAATTTATTTCAAAGCAATTTCCTGCCGTCTACGTGGGACAATACGACGAAGGCAACAATTACGGCCAAAGATGAAGACATCAGATGGAGCAAAAGACAGAGACGAAGCCACACACATACACAGACAAAAAATCTCATATTACGTATACGCCGCAGTGATTTTTCCCTTTCGCGTCCTGTCTCCATTATAATGAGTTCACACGCCGCTGTAAGTCTGTGTGTGTGTTTGTGTGTATTTCCCCGAGTGGATGTGTGTGTGTGTCATGTGTTAATGACTCTGTGTGAAATAAAATTTATGACTTTATGCAACTGCTGCCCGCGCGCTACTGCCTTAACATTATTATTATTTTGCCTTTTTGGGCCATTTTTTAATATTTGCCTCGGCGCCGAAAAGTAGGCCGACATTGTTGCCGCTGGCATTCGTTGCAGGAAAAGGAAATGCCGCAGCAGCACTTGCCTTGCTCTGCAGAGTAGAGCAGGCCCTCCATTC


Search Again