CR00250

CRIMIC CR00250

Gene wg

CG4889

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 short band no bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
AGGCCCGGATCCGGAGGGATCGG

Amplicon 5' Amplicon 3'
CCCGGGAATTCGTCGATACCGGCGAGAGGGGTCGCAATCTGCGCGAGAAGATGAATCTGCACAACAACGAGGCGGGTCGAGCGGTAAGTTTAGATACCCAGCATTAATACACTGAGAAACGAATACAAATAGAGCCAAAATACTACTATACAATACTATAAGAAATGAGGTATGATTTGGCTTTATTTCATATGCTCTTTTCGCAGTGTACCTCGTAATAAGTAGTCCAAATGTTCGGTTTTAAGCCTGGCTGGGCGATTTACGACTGGAGCGCTAATAAAAACCAGCGACGACAATTTCCGTCCCCACAATTAATTGGAGCCGAACGCCAATTGGCCTAGCTTGTAGAGATTAGCGCTCTCTCTTTCGCTCCCCCTCCAGCTGTCTCTTTCATCCGAATGAGAATGTGGGGGGATTTCTGCACTCGTTTGCGCTTGTGTCGCTCGTATATTAACTCGTTGACAGCTTCCAGTTCCCCTCCACATGCAAGAAAATAGTAGGACTCTAGTTTTAGGGGTACAGTGGTCGAATGTTGAGAAAATTGTGATTATACAGAAATGTAAAAAGAGCTGTTTTCTTAATTACCGATAAATGAGTTTTAATGGTGGGATAATAGTTAGTTTTTCACATATTGCAATGGACTTTTTTGGCCTGACCAAACCACTGTGCACCGTCACTCCTGCTATCCATTTTAGTGGGGCGTAGAAAGTAGCACACTGCGCCAACATCCACTACATGCACTGTATCCAGCTAGAGTCGACCGA GCCTAGTCCTCCGACGTTTTTGGGGAGGGAGCAGAGCCCACCGCCTGTGTTATTATTTTATTACTTGTTATGGGCCGCAGCTCCGTAATCATTGCGATCAGCATGATGATGATCATCGGGCTGCTGCGGCCGCTGCTAACCGAACTAACTGAGAAGGCCCCCAACTGCGTTGATTTCTTACTTTTGGTCCGCGCACAACAATTACAAACAGCAACTTCGGGGGGGACATGCAACAAGCGCACAGCAAGTTGCAACAACATTTATTGATTTTTAATAACTGCAACAACGTGGCAGGCGGGCCGCCAATCTCCCAGCCAGCCAGCCATCCCATCCAGCCATTCAGCCAGCAAAACGGCAAAAACAACCGGCCAAGAAAAAACAGCAAAATAATTAAGTGAAAAACATATTGCGAGTCGATACGCAAGAAGCCTAATAAAGTCATACTAATGAACAATCTCTCCCCGCTCTTTTCTCATCTACAGCACGTCCAAGCGGAGATGCGACAGGAGTGCAAATGCCATGGCATGTCCGGATCGTGTACAGTGAAGACCTGCTGGATGCGACTGGCCAACTTCCGTGTGATTGGCGACAATCTGAAGGCCCGCTTCGATGGAGCCACCCGCGTGCAAGTGACCAACAGTCTCCGGGCCACCAACGCTCTGGCCCCAGTTAGTCCGAATGCAGCCGGCTCGAATTCCGTGGGCTCCAACGGCCTGATTATTCCGCAGTCTGGTCTGGTCTACGGCGAGGAGGAGGAGCGTATGCTGAACGACCATATGCCGGACATC


Search Again