CR00212

CRIMIC CR00212

Gene Top1

CG6146

Information

Donor HA-L PCR HA-R PCR Stock number
pM36 OK no bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
TCTAGACAAAGAAAAGAGGGTGG

Amplicon 5' Amplicon 3'
GATCAGTGCGCATTGCTCAGATTCGTCCGAGCTCAAGGCAACATGCCGCCATGTGTTTTTGGCTGCGAGAAGTTTTCGGATGTCACTGACCTACATTTCCGAAAGTCACACACTCAGCGGACGGCCGACGCACAGTGGCTGCCGCAAGTTATTGTCCGCCTGTGGCTCGTCGCACAGTGGCGTTCGTTTGGGCGACAACTGTTGGCGCTCACTGTGCGGCGAGCGCCATTCGCCACGAAACGCATGCGTCGCTCCAGCCCCTGCTCCCCCCGCTCACCATGTACAGTTGCAATGAAAAAAAAAACAGCTGAGCAGGCCGAATAATGCGCATTTGAGGTTAGGTTCGAACGCGGCTGATTGACTGCTGCTTTGCGTAATGCTATAGATAAATCGGAGATATACCAAACCAAATGTTGCGCTCTTGGGTGGCATTGCGTCCATTCGAAAAGCAGAGTGTCTGCCTGGTGCTCGGACAGCGTATGTTGGCCGTAGCCACCGTTGCGGGCAAACGGAGAAGAGTGCGACGGAAGAGCGTCCAGGAAGAGCAAATTCGATGGTGCGACT GACAAAGAAAAGAGGGTGGACCCAATTGCTCTTGATTACTGCTAGCAATGGCTAGCCTATGCCTATGCCTAGCCTATAATTTCTATAAAAACTAGAATAGTAATAGTACCCATTTATATTAGAAAGTTAATTGATAATATTTCTTCGACAATCGGGGGTGCTTAACATTTTGAACTCAACTATAGAAGGTTCAGTCTTAAAGCTCCTATTATCCGCGCCTGTATATGAAGCACTAACCCGAGTCATCCTACATTCCAGGTGGGAGGAGGAGAAGCGTGCCGATGGCGTCAAATGGTCAACGCTGGAGCACAAGGGACCCGTGTTTGCACCGCGATACGAACGGGTGCCACGCAATGTACGGTTCTACTACGATGGCAAGCCGTTGGAGCTCTCTGAGGAAACGGAGGAGGCAGCCACGTTCTATGCCAAGATGCTGAACCACGACTACTGCACCAAGGAAGTGTTCAATAACAACTTCTTCAAGGACTTCCGCAAGTCCATGACGCCCAGAGAGAGGGAGATTATCAAGGATTTCCGCAAGTGCAACTTCCAGGAGATGTTCAACTACTTCCAAGCGGAGTCCGAAAAGCGCAAGGCAGCCAGCAAGGAGGAGAAGCTGATCAAGAAGAACGAAAACGAGGCGCTGATGAAGGAATTCGGATTCTGCATGATTGATGGGCACAAGGAGAAGATCGGTAACTTCCGCCTGGAGCCGCCAGGCCTGTTCCGCGGTCGTGGCGAGCATCCCAAAATGGGCATGATCAAGCGGCGCATCCAAGCCAGCGATGTGTCCATTAACTGTGGCAAAGATTCAAAGGTGCCTTCACCGCCGCCCGGATCTCGCTGGAAGGAGGTGCGCCACGACAACACGGTCACCTGGCTGGCCTCCTGGATCGAGAATGTGCAGGGACAGGTCAAGTACATCATGTTGAATCCCTCCTCGAAACTCAAGGGCGAGAAGGATCACATTAAGTACGAGACGGCGCGACGCCTGGACAAGGTAATCGATAAGATACGTGCCACCTATCGCGACGAGTGGAAGTCCAAGGAGATGAGGGTTCGCCAGCGAGCGGTGGCCCTTTACTTCATCGACAAACTGGCGC


Search Again