CR00197

CRIMIC CR00197

Gene CG2852

CG2852

Information

Donor HA-L PCR HA-R PCR Stock number
pM36 OK no band79229

Images

Construct Sequences

sgRNA sequence
GCACTTTGTAGGTTATAGCGGGG

Amplicon 5' Amplicon 3'
ACTTTAGTCGGTGGCATCGGCCTTGGCCACGGAGAAGGCCTCCGAAACGGGCAGGGTGCCGCTGTTGGCGATGACCACATCCTTGACGGGACGGTCGCGGGCATCAGTGGCCGAGTTCTCGATCTGGCGCACCACATTCATGCCCGACAGGATCTTGCCGAAGACGACGTGGCGTCCATCCAGCCAGCTGGTCTGCTTGGTGGTGATGAAGAACTGCGATCCGTTGGTGTCCTTGCCAGCGTTGGCCATGCTCAGCCAGCCGGCGCCATAGTGCTTCAGCTTGAAGTTCTCATCCTCGAAGCGCTCGCCGTAGATGGAGCGACCGCCGGTGCCGTCGCCCTTGGTGAAGTCACCGCCCTGGATCATGAAGTCCTTGATGATGCGGTGGAACTTGCTGCCCTTGTAGCTGCGGGGTATAAGAGCGTTGCATGATGGTCAGTTTTGTCAGCATGGGAATTTAAATTTAAAAAAAAACTGGGTTTAGAACTCGAAACCTAACCAAAAAAGAACATGCATACTTATAAATTCAGAGAAGAAAAAAGAAATACCCAAGAACTGCACTTTTATAGTATGGTAGACTTAATAACAGTTGGCGTTCTTTGTTAACCCATTAGTGCCGCTTTGTCAACTGATGTATGCGATTGGCCGCTCAAACGCCACGTAATTGCTTCA TGAGAGCCCCGCTATAACCTACAAAGTGCCGCTGATTAGCGGCATCTTTTGCTGGCCTAGCGGTACCTGGCACCCTACTATGTTGGGGTATTTTCGGTACTCAAGTACCCTACTCACCCCTCGCCCTGCGGCTTCAGCGCCAGCTCCTTGAAGTTCTCCACCGTCTTGGGCACCGTCTTGCCGAACAGACCGATCTCGATGCGACCAGCGGGCTCGCCGCCAATGGTGATGTCAAAGAAAACCTACGCAATCGGAAGCGGTTTATTATTAACAAGTCATCTCACTTGATTTATGGCGCAGCAAATGTGTGTGTGTGTTTGTGTGTGTATGTACGTGGTGTATGCAGAATGTAAGGACGAAAGTCCAAGGAGCACGCACCTTCTCGGTCACTTTGGGACCCTTGCTATCGTCGGCAACAACGACGCCGGCCACCAGGGCTACCACGAAAACGGATAAGAACAGCTTCATCGTTCTAAATATTCACAGCGCTTCAGTTTATTCCTCAAGCGACGTCGCCAATGGATATTTCACGACTGAATTTTCGGTTTCTGTTAGTGATGTAAGAAAACTTTGTTGCATCGCCAATCGATGTTTTCCATCGTTTTTTATGTTTTTGTCGAAATATCGATGCTTAAGTGTGACCATTCGATGACGATGTCTGATGATCACACATTCGGGCGGAAAATTCAAATTCAAATAGTTAATACGCCGAAAGCATAAGTTAAGGTTTTCGTACGAAGGAACAAAGTAAGTTCGAAGAGTTGACTTTATTGGTATAGTTTTTAATATTTTAGGGATTAGAAGTCCAGTTTGCATTAGCACGTAGCATTCTCTCTTGTTTTATTGACGGTTCTGTACACAAAAAGTAAGTAAAAAAATATGCTTTTATTTATTGGTGTACTGCTATTTGCGTCTGAGATTTGTCCATATCCTTGGCTGCCTTCTCTGCTCTCTTCTTCTCCCTGCTGGCCAGAACTTTCTCCCTGGATTTCTGGGCCCTTTCAGCGCAATCCTTGGGTCGTGTCTTCAGGGTCATATCATCCACGGCCGCCTGTTTACGGGCTGATCTCGAAATGCATCGTTCCATGCAGC


Search Again