CR00196

CRIMIC CR00196

Gene bsf

CG10302

Information

Donor HA-L PCR HA-R PCR Stock number
pM36 Order from Bellen Lab

Images

Construct Sequences

sgRNA sequence
ACTATGTGCTCATCCAATTTTGG

Amplicon 5' Amplicon 3'
GCGCGCATGAATTCCAGAATCCTAGTGGCTCCTTCAATGTCTCCCTGCTGACAATAGCGAGCAATCAATCGCTGATAGGTCACCCTATTGGGCTCGATGCCCTTCGCCTCGATCTCTGCCAGAAAATCGGTGGGAGCAAACCCATGCTCGTTCTCCAGGTAAACGCGAAGCAGGGCATTGTAGTGCGAGATGTCCATGGGTACATTCAGCGCATTCAGCGTCTTCCAGATCTCCTGCACCAAGGCAGTTCTGACCTCGGGAAGCTCCTCCGGTACCAGGTTGCCGCAGCAGCGAATCACCAGCAGCGATTGCGAGCTGGTGGCCGTCCTGTGTGAGCGGATCTCATCGAGCACCTCCTCCAGATCGCGTCTGGAGATGCGCCCAATGCGACGAACATCCTGGTCCAGCCGGCGAATCTGTTTATCCAAACTCAACTCAGCTTTGGCCGCCGCATTCGTGGCAAAACCACTAGGAAGATAATTAAAAATAAACTTAATTAATATATAAAGATATATGAATTAACAAAATCCTAACGTCCTTATAGATTATTTTCCGGCTGACCTTAATGAGAAACTGAGTTGTTATAAGATAATCGTGTTGCTTTTTGAATAAAAATAAGATATTTAGCTTCTTTCTACATATATAACTAGACTTTCTACAAGAAAAACGCTCGACTAAGGCCA GCACATAGTAGGCGCTCCAAATCCGGATGAGGTTATGTAAATATGTGAGACATCAGTCGAATGCAACTGCGATGATCCCAAGTGGCGGCACGTGCGCCTCTTTTCGGGATTCAATCGCTGGAAAGTGGACGATTCCCCACTAATCACGTAAATACATGAGCACATTGCGTAATGCCGGCGATTTGGGGCCAGATTTTACTCACTTTTGGAACTGGCCGCACATGCAGGGCGCATTGTTCAGCAGATTGCTCGTCTCGTTCTCGCGAACCGAGTTCACCAGCACATTGCGTGTGAAGCCGGCGAAGTAGCGCAGCAGTTTGCCCGTCCTCAGGATGGATGCCATGGCGGAATCGTTCGGTTTTAATTAATAAATGAGCTTATTATTAAAATGACGTTCGCACGAGTGCGGCTGAAACCGATGTCTCTTCGCGCCTATCGATGTTTACCTGCGACAATCGATTGTTTTCGGTGGGACCAAAACGTTCAAATCAAATGTATCAGCTTAGCGGTGACACAAACGAGAGGATATTTGAACAGTGCCTAAGCCTGTCAGCTTAACCGATTTAATTTGCTTTTTTTCGGATCGGAAACTCTAATCGTACCCCGTATATACTTGAACTAAAATGTCTCTGAATCTGCAGTACGAGGACATTGGCAAGGAATTTGTCCAGCAGTACTACGCCATATTCGATGACCCGGCGAATCGGGAGAACGTGATTAATTTCTATAACGCTACCGACTCTTTCATGACCTTTGAAGGCAACCAAATACAGGGAGCACCCAAGATTCTGGAAAAAGTTCAGAGTCTGAGCTTTCAGAAGATTGCCAGAGTGATAACCACAGTGGATTCGCAGCCAACTTCCGATGGCGGAGTTCTGATCATCGTCCTTGGAAGACTAAAATGCGATGACGATCCCCCACATGCATTCTCGCAGATCTTTTTGCTGAAGCCCAACGGAGGATCCCTCTTCGTGGCTCACGACATCTTCCGTCTGAACATCCACAACTCTGCCTAGGAGCACTCCAGACCCATATGTACACCACACATAATCGACATCCAAAGACGCCCAGCGCCTAATAGTGAT


Search Again