CR00195

CRIMIC CR00195

Gene mEFTs

CG6412

Information

Donor HA-L PCR HA-R PCR Stock number
pM36 OK OK78881

Images

Construct Sequences

sgRNA sequence
TTTAGGAATGGATGCAAAACCGG

Amplicon 5' Amplicon 3'
GTTTTTGCCTTTGCCCCCAAAGCTAAAAACCTTTCTTTTTGCTCTTTCTTTTGGGCTATCGCATGACCAAGTGGGTAATTACGGGAAGCAGAACAAAAAAACACGTTTGTAAACAGTTCATTCTGCTGGCGTTGTCCATTCGCCCGTTCTTCCCGCGGGTTCCACTGCTTCAGCGACCGGAAGCCGCTCAAGCGTGCTTCCCGTTCTGCGCAGGCGCATTCTCCTTGGTCACCCCAATTTTTTGCCATGACTCATGGGGTATGGCGTATTCAAATAAGAGAGGTGGAGATCTGATCGTAATGGTTGTTTTACTTGTTTTACATGCAAATTTTGACCAGAACATTGTCCAGAATTTCGGTTTTAACAATCTTCAGCTGTTGTGCTAATAACAATTTAGTGTTCTAGACTCTGCTTAATGGCTAGTTAATTGCTGCTCTGGTGCTGCGAGCGAATGATCGCCTCCAGGCTGCGTTCCGTGTGCTCTCCGCACTCGAAGCGATGGTAGTCGACGATCTCGCAGTTGTGCTCCTGCAAAGCCTCGCCCACCGTCTTGTCCGCATCGAGCAGATACTCCTGGTGAATCAGGCACGTCTCATCGTCCTTGTTCTCCGCCGGCTTGTCCTTGTCATATTCGCCGATCTTTGTCGGCTTCATGCCCACGATTTGCTGGCAAATGCTCTTGTGAAACTCAAAGTCCAGCAGGGGGTGCGTGGATCGGTAGGCTACGATCGCTCCGTACTTGCCCACCTGGGTGATGCCTTCCGTGGTGCCCACATTGGTGGGTGCGGGATGGGCGTAGCCCACCAGCTTCAGGTCGTTGTTAGCCTTAAAGCACAATGCGCGCCGGATGGTGGCATTCTCCCCGATGGCGCCGATCAGCAGAGCCAGGTGGTCGCCCAACGTGCGTCCCTCCTCCGTGCGCAAGTTTCTGAGGGCGTCCGCATCAAAGCCAAGCTGAAAGGATATGC GGAATGGATGCAAAACCGGTTCTGATCCAAATATTGTGTACATTTCCCATAAAAATCTCGCTCACCTTCCACAGATCTCCATCGAAGTCCGTCAAGTCCGTGTATTGCAGACACATGCAGGCGACGTGGTCAACGAACCGCTTGAAGGTATCGTTCCTGGCTACGAAATCCGTCTCGCAATTCAGCTCGACCATGGCGCCCCGGTTTCCGCGGATGAGCACTCCAATCAGACCATGTGCAGTGGCTCGATCTGCGACCTTGGTGGCCTTCGACCAGCCGAGGGTCTGGGCCTGCTCGTGCAGCCACTTTTCAGCCTGCAAGAGCGAGATGATGGCAAGGTGAGTTGATTAGCACAGATGTGTTTTGATCACAAAGGAGTTTGCATGCGGTGCAGCTATATATATTACATAATAATATAGAAAAATCAGCAATTTTTCAAAATGTAGAGATCCCCATTTCGTGCTCTTTGTAATGGAAAGCTCACTGCACCGCTTGCAATAAAACTATTAGCCAACTACCCACCAATCCGACGTCGTTGTTGTGCTTCTCCAGCGCCTTCTTGCAATTGGCGAAGGTGTATCCGGTTTTCTTCCTCAGCGCCGCCAGGGCACTCTTCTCCAGGCCACCGGATCCGCCAGAGCCGGCATAAAGCTGCCGCGTGGAGTGAAGTGCGCGTGTGAAAAACCTTTGTAGCAGCATTTTTCCAAAAAATTTCCGAAATTTACTGGGAGGCCAAAATGATTTCTAGCGTGATTTGTGTGCGAATTGAATTGTTGCTCTTTGCCTGCTGTCAAGGGCAACTCGCCGGCTTGTTTGTTTTTCCGTTTTCCGACCTGTCGCTATGTAGTAGTTGCCCGGAAAATCAATTCATTCTAAACAACGGAAAAGCCTGTGTGAGATTTGCATTTGTTTTCAACTCCTTCGTATGTTCGCTTCGGTTCAAGAAAAATTAATCGCGTTGCGGCGCGAATAAATCCAAAGCGAGTGTGGTGCCTCGATAGGTGAACGACTGGTAAGCGTCGATAGTTTAGTTTTCGGCTTTTCTGTGTGCTTAATTCGAGCAATTAATTTTGAAACTGAAAATTTTGACAATTTTCCGTGTTGCACAATTCGGCTGTTAGGGATGGCAAAAAAGCCGGTAGGGCGCGTGTGCGGAGAACAGCTGTTGCGAAGCGACTAT


Search Again