CR00192

CRIMIC CR00192

Gene CG1673

CG1673

Information

Donor HA-L PCR HA-R PCR Stock number
pM36 no band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
CGACTTGTTTACAGAGATTGCGG

Amplicon 5' Amplicon 3'
ACTCAGAGATGCAAGGTGCCATTAACTACACTTCTTTACAATTCGGGAATTGGGATTAAATAGGGTCAAGGTTCTTGCTCTTCAAGAGCTGTCAGCAGAGCATGATCAAATCGACTTATGTGTTCAATTTTTTCACACTTGCAGGATATTTTCCGCAATCAGCATCGCCTGATCCGCTTCCTCGAGCAGTCGATCCGGTTGTGCAGCAACCAGTCTCTGAAAGCCGCCCAAGCGGCACAGTTGCAACAGAAATCGTCGGCGGACTTCGAGATCACCGCCTCGCTGGACGCCCAATACACCAGTGCCCCGGAGCCCATTAAGCATGACAAGAATCTGGGTCATCAGTTCCGTGCCTCACAGATTTCCGTGCGACTGGCCGCACCGGAGCAACTGCAGCCCAAGCCGGACAACGATGAGGAATTGGGTTTCGGCCGCCTATTCACCGATCACATGCTCAAGATCTACTACCACAAGAGTTTGGGCGGATGGCAGCGACCGGAGATTACGCCGCTGGAGAATCTAGTGATGCATCCCGCCGCCAAGGTCCTGCACTACGCCGTTGAGGTAAGCCATCGGTCCTGCGTTTTCACACTAAGAACATATCAGTAACAGCAACAAAAAGCATAGCTTAGAAAAAAGTTGAACAATGTAACTAGAATTCCTTGTTGAGTGCAAATATTTACGTGACTTGAAAACGCTTCGTAATCCCCAAGTCCCCAG CCCAGACCGCAATCTCTGTAAACAAGTCGCACGTGTGACTTGTGAAGCAACGTCATGCAGATTTATAGTATATATGTACATATAGTGTAGTCAGAACCCAAATCGAAATCAGCGACTGTTGCCAATGGTGCGATGTTGTCTTATCACCTCTGTAATGCCATCCATTCCATTGCAGCTCTTTGAGGGCATGAAGGCGTACCGCGGCGTCGATGGCAAGATCCGCATCTTCCGGCCGGACATGAACATGAACCGCATGAACCTGGCCGCCCAGCGATCCGGTCTGCCCACCTTCGAGGGCAAGGAGTTCGTCCAGTGCCTGTCCCGCCTGCTGTCCATTGATTCCGAGTGGGTTCCTCACACGGACACCGCCAGCTTGTACATCCGCCCCACACTGATCGGCATTGATGTGAGTATATCTAATTAACCGTATCTACTTTGGAATATCATGAGCTTACCTGTTTTGATTTCGACTTGCAGCCCACACTGGGAGTTGCTTCCTCCGACTCGGCCCTGCTCTACACGATCCTCAGCCCCGTGGGCAGTTACTTTAAGACAGGCTCGTCCGGTGCCGTCTCCCTGCTGGCCGATCCCAGTTATGTTCGTGCCTGGCCAGGCGGCGTGGGCAATCGCAAAATGGGCTCCAACTACGCACCCACAATCAATGTGCAGAAGGAGGCGGCCGCCAAGGGACTGCAGCAGGTGCTGTGGCTCTACGGCGAGGATCATCAGCTAACCGAAGTGGGCACCATGAACATCTTTATGTTCTTCGTGAACGATCAAGGAGGTTGGTGTCTAATACAGCAGCAAAACGAATGGGATTGCTTATATATATATATCTATGTCATTTGCAGAACAAGAACTGGTTACCCCACCGCTGAGCGGTCTAATCCTGCCCGGTATCACCCGCGACTCCATCCTGCGCATGACCCGCCAGTGGGGCAAGTTTAAGGTTAGCGAGGCGAACATCACCATGCCCATGGTCTGTGAGCTCCTCAACCAGGGAAGGGTAAGTAATCTAACAGAGCATTTCCCCCTCG


Search Again