CR00189

CRIMIC CR00189

Gene Ass

CG1315

Information

Donor HA-L PCR HA-R PCR Stock number
pM36 OK OK78880

Images

Construct Sequences

sgRNA sequence
AGAGAGGCAATCCAACCCGACGG

Amplicon 5' Amplicon 3'
GGAGTACTTCGCGGTCCAAAGCAAACACCTCGAGGTCCTGGTGGGCAGCAAAGAGGATGGTGCCTCCAGGCGTCTCGTACACCCCCCGGGACTTCAGTCCCACAAAGCGATTTTCCACGATGTCAATCCGCCCAATGCCATATGATCCGCCAAGCTTATTGAGGAAATCTAGCATCTCCAGGGGTTTAGTGTAGACCCGACCGCCGGGCAAATCCTCCACACTGGAGGGCAGTCCCCGATCAAATTGAATGACCAAGTGAACCGGATCCCGTGGAGCCCTTGTCAGGGGATCGACTGTCATCTCGTAGAGATTTTCCGGAGCCACTGTGTTGGGATCTTCGAGTATTCCGGACTCGTAGCTGATGTGCAGGATGTTGGCATCGGTGCTCCAGGGTGTGGCTGGCTTGGCGCTTACCTCGATTCCGTGTTGCTGGGCATAGGCAATGAGGTCCTGTCGACCTTGAAACTGGCAGCAGAATTCTACATCCCTCCAGGGAGCGATGATCTGGAAAAAAGTCGATTTCGCGTTTATAGCACAGTCAAATCTTTAAATTTGATCACATATGTATATTAAATTTCTATTTTCTATTTGTCGGTTGAAATGGGGCTTTTTGACGTTACTAACACTCAAAAGAACATTAATTTAGTACCAGTTCATATAAATCGATCATTGTGATGAAATATTCTGCCTGCTAAGCAACAAAAACCATGGCAAACCAAAAAGCTCTTGACTTCTTTATTTGAAATGAAGAAAAACTAAAAAATAGTGCAATCTTTGTGATTTCAAAGTAACAAGCAAAACGGATTTAAGCCGTAACTTGAAATGGATTTGATCAGCATGTCGACGAACCGGTTCTTAAACCGGAACCTACTCGATCGTTACGGTTTAAACCACAAACCAAAAGCTAAAATTTTATGCGTTCACGGCACTTCTTGTAGCATTGATTTGTTTATAGATTACACTCAAAGATGTTAATGTAGCTAGTCAGACAACTTGGGTACGCACAACTTTGTTGTTGACTTGGCGTGCGATA AAGAGAGGCAATCCAACCCGACGGGTCTTACCACTCAATTAGTACGGATACCTCTAAAAATTTTGTACGTACCTTCAGATCCGGTTTCAGGGCGTAGGCGCACAACTCGAAGCGCACCTGGTCGTTTCCCTTTCCGGTGGCTCCGTGGGCCAGATACTTGGCTCCATACTCGCGGGCGACCTCCATCAGGGCTACACTGATGCAGGGCCTGGCCAGAGAAGTGCCCAGTAGATAGCGCTCCTCGTACACCAGACCCATTTGTACGGCCGGCCAGATATAGTCCTCGACGAAGGACTGCTTGACATCGGCCACGATAACCTGAGTCGATAGGACGAAACAAGTATATATTCGAAAATTAATTAATTCCGAAATTTCAATTTCATCCGACATGTATCTACATATGCCACACTTCTGGTTGGACAACCTTTTTTGCGCCAATCTTAAGAGCCTTCTTCTCGGCGGCGGTGAAATCTTCCTTCTGGCCTACATCGGCCAGGACGCAAATGACCTCATACTGCTTGTCCAGCAACCACTTGAGGACGCAACTAGTGTCCAGGCCACCGGAGTAAGCCAAAATTACGGTTTCCTTAGGCATATTTCTCGGATGCCCGTCCACTTGTCACGGTTGTGCAAAAAATACTACATTTCTATGATTATTAGCTCGTTGAGCTTGGAGTAATCTCCGTCTAATCAAACCTGCTTATCAATCCCTACGCCTCGTTCCCTTTGT


Search Again