CR00184

CRIMIC CR00184

Gene Aldh

CG3752

Information

Donor HA-L PCR HA-R PCR Stock number
pM36 OK OK78879

Images

Construct Sequences

sgRNA sequence
CAGTTTCCACTTCTTATCACCGG

Amplicon 5' Amplicon 3'
TCTCCGGTGTAGGTCTTCCCCATTTCGATTTTAACGAAAAGAAATTGGCAAATCAGCGCAACGCAAGCGAGTCTCACCGCATTCAGATCACGTACACCAAATGTTTATCGGCAGATGTAGGGGATTGTAGGGGATTAGGCTGCTTAAGCGAATCGAAAGACCGGCGACTAAAATAAATATACAAAGGCGATATCGAAAAAGCAAAAACAACAATCGCATATGTAGTTCGCCGGCTATTGTTGTTGTTATTTCTGCTTCAGCTTCTCATTGTTTGCCATACCCGGTTTCTTTGTTACGTCAGCAGTGGCGCTCGCACACGCAAAACAAAAATTTGTTTGCCGCAAATTCTCATCATTTATTCTTCTCATCGCCTCGCGCTTTCATTTCTTCTCTAGGGAAATTTGCATAAATTTAACCATTGTCATTTTTTATCTTTAGTGTCACCAATTAAAACTAGCGTTCGTTCGATTTAATTGAAAAGGAATTGCGGTTAGGAAGCGAGCCAAATGTGGTTTTTGTCCAGATGTTAAATGGGATCCAATGAAATTAGAGCAGTTCGTATATAGTAAACATTTTTGCAGAAAAAACTTGAAAATCCAATGTGCACGGTTTTTATTTGTCTATATATATTTCAGAATTTTTAAAGAAACTCCTAGCTTACATCGCTCTTAAACTGTCTTTAAATAATTGTTAGTGTTCTATGTTTTCCAAAAACAAGGAAGTTCTTAAAAATTTGTATATAATAAATATTTTTGCAAATGAACTTGATTTTCAAATATGCATGTCTTGCATACCAATATATTTTTGTTTTTAAGTCTAAAAATGAAATCTTGCATACCTCTTAAATTGGCTTAGAATAGCAAATAACATATATATAGACCATATATGTACATATATGCTGAACCCTAAAGCAAAATATTTCAATTTTACAAGAATTGAGCATTCGTCTATTTTGAGTGAACTGCATATTATGCAACCTTTATAGTACTTATACATATGCCATAATCTGAGAATCTGCTTTCATAACAAGAAATATCAGCCCATAATGTCTCGCGCACCACAAACGTTCTAATCTCTTGATTTATCTTATTGTATTTGTGTTTGTTGGCATAGGCAGTTTCC CGGCAGCCCTATTATTTTGGGGGTCTTTACTGGGCGAGATAACATGGCACACTTATAAGATTGGCTTCCCTAATCGAACCAGTATTAGACTCGTCTAGCCAGACCCCCGAAAACTAATGCACACGTGCGTCGTCGCTATGTTTATATTTTGCTATGTCTGGCGGAAAGTTTTATATTCGCAAGCACATTGTGAAATTCAAAAGTAGATGTATGCAAAAATAAAAACAAAAAGAAATAAAAATGTTCTATAAAATAGGATGACGTGAGGGGTTGGACGCGAGGGCTCACTTCGTTTCAATTTTAATCAGTTAGCCGGTAAACGTTTTAGATTACCCAGACTGGGGGATTGTCAGATTCAGGTAGCCATGCGAACGAAACAATCAGTCAATTGCGATAGAGGAATAACACGCACGGCAGGCAATAATAACAAATAACAGCAGTCAAGGGCTTATCATATAGAGGAGTGGCTTGTTTGTCAATCCAACAAAACGATGTAAAATACAAATGAATTCAATAGAAGAGATTGTGAATATGATATGGCACTAATTGAAGCTGTTAACTACTTATTGCAGGTATTTATCAACAACGAGTGGCACAAGAGCAAGTCGGGCAAAATATTTGAAACCATCAACCCGACCACAGCGGAAGTCATTGCCGAAATTCAGTGTGCTGATAAGGAAGATATCGATATTGCCGTCCAGGCTGCACGCAATGCATTCAAGTGAGTGTGCAATTTGGATATAAATCGACTTTGCTTATTAATAACAACTCTATGATCACTAGGTTGGGATCTCCATGGCGTCGCATGGATGCCTCGGAGCGGGGTCGCCTGCTCTACCGCCTGGCTGATCTCATGGAACGCGATCAGGTC


Search Again