CR00183

CRIMIC CR00183

Gene Actn

CG4376

Information

Donor HA-L PCR HA-R PCR Stock number
pM36 short band no bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
AGTAGGTGGCAATTGAGGTGGGG

Amplicon 5' Amplicon 3'
AAAGCTCTAGCAGGTCTGGCAGTCTGGCAGCGGCGGCAGCAACGCACTCGCTCTTGCACACCCATTTTTAGCCGAGTGTAATTTGAGCGGCCCCATAGCATGGACTCATTCGCACTTGGCCAGGCCGGGCCAGGCCAGCGGATGGAGGAGTGTGGCAACCTGGCAACCCTGGCCGCTGATCCTCCTCATTCATTCACACCTTTCGCATACATGAGTCACGCGGCGGAGCCTCACCACCCACTTCCACACCCACACCAACGCCCATTCCCTCTTTACACCTTTTGTTGCGTTGTTGCGATCAATGTAAACACAAAACAGAAACAATTTCGGTGGCTGTTTTCTTTCTTTTTTCGGCTCTCATTATTCAGCAGCTGACGAATTCCGTTCGGTAATTTACGGTTACGAAATACGTACATATATCGGACGAGAGGAAGAGAGACAGTCGGAGAGATGAAGAGATAGATGCCACGCATACATGTCCGATCATGTCAAGCTCAAGTCATTCGGCGACCGCCAAAAATCTTCATATTTTCGCTTTATTTTGCATTTTTGTTCGACTTTTTTCGATCTTTGTTAATTATTTTCAGTTTCGTTAGTGCGCCAGCGATTTGTCATTGCATTTTCGCCATGCTTTATGAGTGTGGGTGGCTGATGAATTTCGGATACAGATACAGAAACAGATACAGATACATGGGTATATTCTGAATCCGAATCGCGTGGAAATGTGGTGCATAGGAATGCTGTCTATTTATAATTGTCAATTTCATTTCACCACCTAGGCGTCGTGTCAAAAACACAGCCTTGCACTACATTTTGGCTGGCAATTTATAGAATTATGTATATAAATACTATATCTCTAGGTTAGAGCTCTTGGGTATGGAATGATATGGGCAAGGGTGCGGGCTCGACACCATCCTCGATACACTTGCCTTTAGGCTATCTAACGTTCCTTTCGGCCTGTTGGGCTCTTATCGCCTACGACCTTCAGGTTTGCTAGATGTCCCCACCTCAATTGCC AGATCGGTGTTTCCAGCTTTATCTAAACAGTGGCAATTAGTTGCTGTTCTTCTTCTGACGCCATTTGTATAACGGTATGCTTCCGCTGGCACACAACGACAAACAACAAGCAAACAAACAAACATGCAAACAATCTGAACGACGAAAAAAGAAGATGAAAGGGATGGCAGGGGTAATTGATTGGAAACTGTTTGGAAAATAGATTGATTGAGGGTTTCATTGGGTGCTCTTAGGTGATGTTCAGATCGCTCGCCCCCAGACAACAGTGGTTGGTAGAATCGAATGAGATTTTCGATTTTCATAATCATCAGAGATCGAAGGCTTTTGGATATAGGTTCTATATGTACTACATATATATGTATGTATAGTTCCTGTACAGCAACAAACTATTTTCGTGCTATCTTCAAACATTGCTAGAACAACAAGAGCCATGAAAATCAAGAAAGAAATATTCTATTTTTAAATCGGGCCGCTGAGCTTTTTTGTAGTTGTTGTTCTAGCTTTTTTGTGTTAGTCCCATATTGTTGTTGTGCTGCTTGTGCTGTTGGCTCGGTAAAATATTGAAACATAATCGAAAAATATAGAACCCAGCTAGACCAAAAAGCGTATATCCAACACATATGAATGTGAACCGCGGCTA


Search Again