CR00158

CRIMIC CR00158

Gene CG30344

CG30344

Information

Donor HA-L PCR HA-R PCR Stock number
pM36 OK OK78878

Images

Construct Sequences

sgRNA sequence
CGCCAGTCGAGGCTTATCAACGG

Amplicon 5' Amplicon 3'
GGATCGGACGCGGATAAAGTAAGTATTTAATTTGACCCTTATAGTATACACATCATGTACAATTTGATATCTGTACTTTGTGTAGTTTCTGTTCTCGTTGCCTGGTTTTTATCTCTGTGCAAATTATTTTTGCTGCTTTGCTGGGCGTTTCGTGTTGTGATTTTATGGCGATGAGGAAAATGGCAATTTTAAACAAATTTATCCAGTAACTGTAAACAAAAACTGAAGTTTAAGTTACAAAAACTGCTGAACAATTTTAAAACCACAATTAATGTATCACAATATTAACTTGTTTTACGAGTAATTGCTACTATTATGACCTTTGCTGTATAGAACAATGTATTTCGCATTTGGCTCGCCGATATTCTTCCAAGACGTGACCTACTTAGTATATCTTACTATATCAGCATCCGACGTGACAAAGTAAAATCAAATTAGCAAATCGTCTCAACCTAATGCAAAACTGCCATTGTTTGGAGGCTAGAGATAAGGTAATTAGAACGCCAGTCGAGGC CGGCCGGAATAGAAGTAAGCAAAATCCTTTGTTACTGCATTTCGAAGCAGTATCGAAGTATTTACTAGGAAAGCGTTAAAATTATAATTATACGTACGAGATATGGCACATTGACTCATCCACAGTTGTACAGTTGTGCAGTTTACTAAAGTGAACTTCTGTTTTTTCAGGAAGTCGAGGTGATAGTACAGACGTATTCTGCAAATATTATGATGACAACCTCTCTGCTAGAGAGCATTATTCCTGCCTTCGCGAGTCTGTTCCTGGGTCCCTGGTCCGACAAGTTCGGAAGGCGGCCAATCCTGCTGACAACTTTTACGGGTATATAATCATCAGTCAGGACATCTTAATTGCATCTTGTACAAATGACTCTTATTGTATTTAAAGGCTACCTCACTGGCGCACTCATACTGATAGTAATCACTTACATAACGAGGTCCACGAATATAAGTCCATGGTGGTTCCTCCTTTCCTCGGTTCCTTCCGTCGTAAGCGGCGGAACTTGCGCCTTGATTACTGGAATCTATTGCTACATATCCGATGTGGCCAAGGAGCGAAAGAAGGCTCTGAGGTGAGTATGGGTAGTCTTGATTTATTAATCCAAAGAATGCCATTTCATTTTGATATATTATTTGAAAGAATGGTCCTCAATGAAGCCTCCCTCTGTGC


Search Again