CR00143

CRIMIC CR00143

Gene Gmap

CG33206

Information

Donor HA-L PCR HA-R PCR Stock number
pM36 no band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
TTGCATAAGAGTCCTTTGCCTGG

Amplicon 5' Amplicon 3'
ATCTGCTGACGGAACAGACCAACCAGCGACTCCTGCAGCAACAGCAGGCGGAGTCCCAGGAGCAGCAGGCCAGCACTTTGCGGGATCTGGAACGTTTGCGGGCCCATCTCCTTGAGATCGAGGAGCTGCACACGCAGGAAACTGTCGAGCTGCAGCGCGATCTGGAGGAGTCGCGCTCCCGTCAAGCGATCCTCGAGCAGCAGGTTTCCAAATCCAGTACGGCGTACACATCGGCCAGGTAGGAAAATAGAACAGAACAATTTACAGCTGAGGGAGGGGTCACCTTGGTTGCCATTGGCTGATATATTCGTCACACCAGCGATAAGCGATCGAAGCTGGCTAATTGCATTCGCCACATGTTCCCACACGATTCCAATTCCAATGACAATTGCCATTCCACCCACTCCATTCCGCCGCCGGCGGAATCGGACCATGCAAATTGCCGTCCATATTTCCGCATGCCTGGCAGTTCGTCTTATCGCCAGTTGGCAAATCAATTTCGACCTGGTTTGGATATCGTCACTGGGTGCTC GCTGGCACCAGTTTGGACTAACTGCAGTTGCTATTTTTGGTTGGAAAAGGGGGGACTCTGTATCAAGTATCAATTAATTAATTTCGAAGCATTAGATTTTAAAAACTAGATTACTTTATTGAGAACTTTCTGCTGGGTGTTATTAAAATAATTACCTAAATTCAATAAAAAAAAATATAATGGAATTGGGCTTGGGAAAAGTGTTGATTGCTAGATTGTAGATGTGAAAGTAAGCCATGCACTTAAATGCATTTATATAGTTATTAAGTTACTTTTGCAAAAATGCAAAAACCTAGAGAACCAAGGAAATTTGAAATTACAATGAGCATTTCTTCGAAGTTTCATCGTCATTGAGTTAATCTTTTAATTATCCCCCTCAGCATTCGTGCGAATCAGCAGGCGGAGACGCTCCAGGCGCAGCACGCTCTGCTCCAGCAGCAGCGTGATGAGCTATTGGCCAAACTGGGCCAGTACGAGGATCGGGAGCTGAAGCAGCAGGCGGCGCTGACCAATCTGCAGTGTGCCCTGGAGCAGTTCCAAAATGGTAAGAGGACGCACACTATTTATAGCACATGACGATGATGACTAATACGGGTTGTCGTTTTTAGACAAGGATCATGACATCGAAATGGCCACGCAGAGGATTCGCCGCGAGATGCAGGCCCAGTTGGACCGACAGGGTCAGCTCCAGCTGGAGATGAGCGGCCTGCAGCAGCAGCTGGCGGAGGCCAATCAAGGATTGCGA


Search Again