CR00132

CRIMIC CR00132

Gene AkhR

CG11325

Information

Donor HA-L PCR HA-R PCR Stock number
pM36 OK OK78877

Images

Construct Sequences

sgRNA sequence
CACTTCGTTGACCCACTTAATGG

Amplicon 5' Amplicon 3'
TGGAGACAAGAGGAGCCAGTGGTGGTGAGAGGCCGTCGGCCAACGATTGACACTTCGAGCCACCTTATCTGGCTATCAATTTGGTCCATTAGCGACAGTACTCACCTGTCGAGCGATATGCAGACCATCACGTAGCTGGACAGATACAGGCCAAAGACGCGGAAAAAGCTCATCAGGCGGCACATCAGGTCCGTGGATAGCCACTGCACCGTCCAGGCCCACACGATCTCCATTGGCATCAGGAGCAGCGTCACCATTAGATCGGCGATGGCCAGATGCATTAGCATGATATCAATACGCAAGGGACCGCGCAGTCGCCGCTTGGTCAGCAGATACAGCACGGTGCTGTTGCCAATTGTTGAGATCACAAACAGTATGCTGATCCAAATGAAAGACCACCACATTAGGTACCGGGAACACGGCGGTGCAGGAGGAGAAGGTTCAGAAGCGATTAAATTGGTGAGTGGGAAATTAAAGAAGTTTTTTCCCGAAGGTGGGTGTCGGCGTGGGTGCCATTAAGTGGGTCAACGAAGTGCA CGAAGTGCAGTTGGAAAGGTAAACTTGTTGAATGAATGAGGTAAATGAATCGTACTCAATTGGTATCTATTGCAGACAATCTGGGCAGACAAAATTGATGTCCCTTCGAAGTAGCCAAATAGGGTGAATTTGAATAAACAGTTTCAGAACCGGTCAATTATATTGTTAATTTCAGGCACCTTTGGCTGCTGTGCTAAATTAAGCACTTTCTACGCCTTGACTTACTGAGCGACTCACACTTAATCGATTAAACAAATCTCTGGCATTCTATAAATTGAACCCTGCAATGATCCGCAAAGTTCAAATTCCAAGTGAGAATGATTAATCTCAGACAGATAGCCAGACACCCGAGGAGAAACCAGCGATGATGACCCCAGTATGATTTATAGGTGTTTATAATTCAGGCAGCGACACCCACATCGCCATATGAATTGATTAGTTTAGACTTGTTAAAGATAGTAAAAGTCAAAGTTGATAAGCTGAATATACACCAATGAGAGACGTGGGCGGTGATCTTGACGACCAGGTTGTAAAATGCTGGTCGGAATTCCACTCACCTGTACACGGTGATGGACAATCGGTGGCCATCATTGAAGACCATATCCTTGGTCAGGTGAATGGTGCCATTGGTGTCGTTCACATTCGACCAATTACTTAGATCACGATGATCATTCTCCTCAGCTACTTTTGCCATTTTTTGGGACAAGCTAATAAATTGTATCTGAATGCAACTGCATCAAGGATTTGCCTCAAAGATAACGTCTTTTATTCTAAATCAAAAGATACAGATACAGATGGATGTTAAGATACTATTTCTTGTTTTCGTTTGAATGTTTCATAATTGATTTTTGTATGCATGTTAATTATTGAAGTTTAAACTGTGTGCTTTATCATTTGGGTTCGTTTTGGGGGCCCGTCATTAAATTATTGTGAAACGTGTGCGCTGCTTTTTGACTTTTCGAATGCTTTATTATTGGCGGCTCAGTCGAG


Search Again