CR00131

CRIMIC CR00131

Gene Adk2

CG3140

Information

Donor HA-L PCR HA-R PCR Stock number
pM36 OK OK78876

Images

Construct Sequences

sgRNA sequence
TCTTGAGGCCAGGAATGTTCTGG

Amplicon 5' Amplicon 3'
GCTATCCAGGCCTGAACTCCGGCGTGGTCCTGCTGCTCCTAAACCGCATCCGTAACTCAAAGTCCTACCTGGAGAAGCTGACCCACTCGGAGGTGCACACCCTGGTCGCCAAGTACTCCTTCAAGGGCCACCTCGGCGACCAGGACTTCTTCACCCTGCTGGGATACGAGTACCCGAACTTAATCTACAGACTGGACTGCATTTGGAACCGCCAGCTGTGCACCTGGTGGAAGGATCACGGATACTCACAGATATTCGACGCTTATTTCCGGTGCGAGGGCAATATTAAAATGTACCATGGCAACTGTAATACGCGAATTCCAGAATAAATAAAATTGTTATAGGAATATTAAATTAATTAAATGCAGGGTATTTTTATTTGGTATAACTATTGTAATGGAACGTTATGTAATATACGGTGAATTTAATCTTAGTTTATAGACCATTATAAATGGTGATATATAAAAATGAAATTTAAAGATAAAAGACAGCCCACACCTATCACCATTTAAAATATCAAAACGATGTAAGAATGTTATCGATAGGCGAGAAGCAACAGAGTGGGAATATGCCGCACAGGGTGTTTCGTGTGAATGATTTCGCCTCTTGTTTCTTATCTTTAACCTTCATTTCTGGCTCCGTTTGGCTATGAATTAGGAGCAGTCCCGAATAATCAGTCGAGCATACGTAGTTAACGATGGCGCCGAATGCAGCAGTACCAGTGGAGCGATATGAGCCTGAGAACATCGGGATCAACGCCATTCTCCTGGGGCCGCCGGGTTCCGGCAAAGGAACGCAGGTGGGTCAAAATTACATAATGATGTGTTTTTTGTGACACGGACGCCATGTAGTCTATAAATAAATACAACGTGTTCAAGTGCGCGGTTTTTGTTTGCAAATAATCGGTGAAGCTCGTTAATTCTCTTGGAAGAGAATTAAAACTGGTGAAGTTATATAAGACGATGTGTACATGGAAATGTATATGTATGTATCTACGTGCCAAGTATGTACATATGCGTCAAGCAGTGTCTTTCTCTTGACCCTGAATCAAATCAAAGCCTTGGCGAGATGTGGCGAATTAAGTGGAACACCTTTAGGCAATCGATTGGGTATTATGCAGACCATCTATTAAAAGGCTACCAGAACATTCCTGGCCTC GCATCTTATCTAGCCGATTGGTTACCTTGCTTACCTTCCGATATGGTGCTAAATTGATTAATTGATTAGCTCTAACTGAAACTTATCAATGTTTTTAATTATGCCCATTTCAGGCTCCCCTGCTGAAGGAGAAGTTCTGCGTGTGCCACCTGTCGACCGGCGACATGCTGCGGGCGGAGATTTCATCCGGTTCGAAGCTGGGAGCCGAGTTGAAGAAGGTCATGGATGCCGGCAAACTGGTCTCCGACGACCTGGTCGTGGACATGATCGACTCCAACCTGGACAAGCCCGAGTGCAAGAATGGATTCCTCCTGGACGGATTCCCCAGGACTGTCGTTCAAGCTGAGAAGGTAGCCACACGTGTGAAGCACTTTGGACTTTAGGTTATAATCCGTTCGAAACGCACTTTGCAGCTCGACACATTGCTGGACAAGAGGAAAACCAACTTGGATGCTGTCATCGAGTTTGCCATCGACGACAGTCTGTTGGTGAGGCGCATCACTGGCCGCTTGATCCACCAGGCCAGCGGGCGTTCGTATCACGAAGAGTTTGCCCCTCCAAAGAAGCCAATGACGGACGATGTAAGTATCTCTATAGGACGCTATCCAAGAACTCTAAATGAAAGCAGACCTTGTGTACTTGCAGGTCACTGGAGAGCCCCTAATCCGTCGCAGCGATGA


Search Again