CR00128

CRIMIC CR00128

Gene csw

CG3954

Information

Donor HA-L PCR HA-R PCR Stock number
pM36 OK OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
AGAGCCAAGGTCGCGCTATGAGG

Amplicon 5' Amplicon 3'
GCTTCCAACTGCAATTGCCATGGCGATGACAATCTCAAGTCTGTCAAGCCAACTAAGCTGAGCAGGCCAGACGGGTAGACTTATAAGTCCCGGCCCCCAGTAGCTGGCTTCGACTCAACTTGCGCTTTTCCACACGGCGTATGCGTGTTTTCGCCACTATTGCCGTTGTTATTGCATTTGTCGCCTTGCATTTGACTGTTTTCTTCGAACTTTTGCTGGTGTGTGCTTTAGCACATATTGTACATATACGTACAGTAAACCCTCCTCGCAGTGGGCCCTAAAAAGCTCTAAGCTATGTTTACACGTTTAGTTCTAGTCGTCAAGACCTGGGAATGATTGCCTTTGGTTTTTGCCAGATGTTGGGTTTACTTACTAATCCTATTCAAATGAAAAGACTGCGGCCGTTCATAGAGTTCCACCCACTGAGTAAAGACCGTACCCATATTCGATTCGTATTGCGCTGTTTGTTGCTGCTTTTGCTGTTGGTATTGCGGTTGCTGCTGTTGTTGCTGGCTCTAGTATTTTGCGCTTTTGTGCGCTTCTCGTATAGTTTGTAATTGCATTTTGAGCGCTCACGTAGTCGCCAGTCGAGCACTCAGTCAGTCAGTCAGTCAATCGCTCAGTTCGTTCAGTGGATGCGCCATCGATCGGTACATATGAATACATATCTACGAATAACAGTCGAACTAATTTAGTCATATATCCTAATAACCATCCACCTCTTTCTCTCCGCAGATGGTTTCATGGCAATCTTTCCGGAAAGGAAGCGGAAAAATTGATCCTGGAGCGGGGCAAGAATGGTTCGTTTCTCGTCCGTGAATCTCAGAGCAAGCCTGGCGACTTCGTCCTTTCCGTGCGCACGGACGACAAAGTAACGCATGTCATGATTCGATGGCAGGTATGTTGAATACGTAACCCCAACTAACCAGATTTTGTAGCCGCCCCTTGCCCCGCGCCCCTCGCAGGGTGCAAAATGCAAATGCAAATCGATGGCAGTGCAGCAACAAAGTCGCACTGGCCATA GTTCCTCATAGCGCGACCTTGGCTCTACAGTCGAGTCGTATGTACATATGTATGTGCACATAAACTCTACAGTTGAGCCTAACTAACAACGATGCTTGCTCGAGCGGAGTGGCAAGAATATTATAAAATCAATTGACAATAATATATTTAAACTCTTTCATCTTGAACGCATTTGGCTATCCGTAATTATCCGTTAACATTATCGAAGGCCTACTGTATAAACTCCGAAACATGCCTGCTTTGCCTTGGCGCGGGCAAACTGCTTGCGCCAGGAGCTTCAACCAGGTCAAGCAGTGCAGCAGTTCCAGTTTCAGCGTAATTCCCCTAAAACAATTTTTCCACTATTACTATAACTTTAGCCGTGAGCGCGGTTTCTGCGGTTTGCGGCTGCAATTATGCCATTTACATGTCTAGCTGGCCTTTTTCCCATTTGACATTGAAGTCACGTTTTCGATTTTATTAGCTAATCTCTCGACGCTCCATCGAACTCGGAGATAGAGACTCTCCACCACGTGTCCCCCCATTAGAATGCCACGATAACAATAGAGTGATTTCCTGATTGCAGGACAAGAAGTACGACGTCGGCGGCGGGGAATCCTTTGGCACCTTGTCGGAACTGATCGATCACTACAAGCGTAATCCCATGGTGGAGACGTGCGGAACCGTGGTGCATCTGCGACAGCCATTCAACGCCACACGAATCACGGCGGCCGGCATCAATGCCCGGGTGGAACAGCTGGTCAAGGTGAGTTCCCTCTCTCTGATAGCAGTGATTCTGGAGCGCACTAATCCCGAGGTGGCTTTCGATTCCAGG


Search Again