CR00123

CRIMIC CR00123

Gene spas

CG5977

Information

Donor HA-L PCR HA-R PCR Stock number
pM36 no band short bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
CCTACTCCTGTTGACATTTGGGG

Amplicon 5' Amplicon 3'
TTTCACGGGGTTAGGGCAAGGAGAGCAGGGGGCCGGAGTGCTGGACGCGCAGACAGCGCGGAATCGATATCGATGGTACGCACTAAAAACCAGTCGTCCTCCTCCAGCGCCAGCAGCAGCAGCACCAAGTCACCAATAAAGTCCAGCAGCGGGGCAGGATCATCCGGCGGAGGACTCGGTGGTCGCCAGTCCACTCACCGCTCGTCGAGCGCCTCAAACGTTGCTGCCGTTGTTGCCGGCGGTTCATCTGCCGCCGGTGGAGGCTCCTCATCGAATCGCCGTAGTCCGGGCAGCTCACCCGACGGCGACGACGACACCACCACCACAGATGACCTGACCCCCACAACGTGCTCCCCACGCAGCGGCCACCACCATTCGTACGGCGGCTACTCGTCCTCTGTGCACAAACAGAACCTCTACGTCGTCTCGTTCCCCATAATCTTTCTTTTCAACGTTCTGCGCTCGCTGATTTATCAGCTGTTTTGTATTTTTCGCTACCTATACGGTGCGAGCACAAAGGTGATATACCGCCCGCACCGACGCGACTGTAATATTGAAATCGTGGTGCAGAATTCCTCCAAGGAGCAACAGCAGTCGTTGAACCATCCTTCGGAGCTGAACCGTGAAGGTGACGGACAGGAACAGCAGTTATCCAATCAGCCACAGCGTTTCAGGCCCATTCAACCGTTGGAGATGGCCGCCAATCGTCCGGGAGGAGGGTATTCACCTGGTCCCGGCGATCCATTGCTGGCCAAGCAGAAGCATCACCATCGACGCGCCTTCGAGTACATCTCCAAGGCGCTCAAAATTGATGAGGAGAACGAAGGTGAGTTTCGGCGACGGGGGTGGCAGCTCCAGTTCGAGTTCGAGTGCTCGAATGCTCAATGAGTCATCGCCCGCTGTCCGCTTTTGTTGTCTGTCGAGTGTGAGAATCAATAAGGCAAAACGCGCGCACAATGGATGCCCCAAATGTC AGGGTTGTCTGCCTTGATGGACTTTTATGGAGTGGAAGTTCTCCAAGCATGCGATTTTTAAATTCTAATGCATATAAGCGTACTCTTTGTCAAATTATTTATAAGAGGAAAGCGAGCTTGATTGAACATAATAGTTATAAAATAAACATAAAATAATATTATTCTATATATTCAGGTCACAAAGAGCTGGCAATTGAGCTCTACCGAAAAGGTATCAAGGAGCTAGAGGATGGCATAGCTGTCGATTGCTGGAGTGGACGTGGTGATGTGTGGGATCGGGCTCAGCGCCTGCACGACAAGATGCAGACAAACCTTTCGATGGCGCGGGATCGTCTCCATTTTCTAGGTAAGTGACCAGTCATATTTCCTATACCCCTAAAACATAGGATTTGTTTACCTCATTTTTTTTTTATTTCATTTTGCACGTTTTCCCCTGCTTTTTTGTTGTCCCCTCCGTTTTGTCCATATGCACATGTTCATCCGGTGCGCAGCTCTGCGTGAGCAGGATTTGCAAATGCAGCGCCTCTCCTTAAAGGAGAAGCAGAAAGAAGAGGCTCAAAGCAAGCCGCAGAAGACCAGGGAGCCCATGCTGGCAGGAATGACCAACGAACCAATGAAACTAAGGGTGCGCAGCAGTGGCTATGGGCCCAAGGCCACCACCAGTGCCCAACCCACTGGTAAGTTCCTCACCAGCTAACGCGCACCCAACAAGATCCTCACACGCCAGCGCAAAGCCACCATAAGCAGATCGATTAGTCAATCCCTATCACCTCACTTGGCACTTGATTTTCTTAGAATTTTTTATTTCGATTGGCCAAATTGTAAACTTGTAAAAGAGTATATTCTTCCGCATTATCCATCTCTGATTGTGCTAATTCGTTCACAGCATCTGGCCGCAAACTGACAATTGGATCCAAACGACCCGTCAACTTGGCCGTGGCCAACAAATCACAAACGCTGCCCCGCAACCTTGGCTCCAAAACATCTGTAGGCGCAGTCCAAAGGCAACCAGCCAAGACAGCTGCAACGCCTCCCGCCGTTCGGCGACAATTTGTGAGTATCTGATAAGTAAACTAAATTTGTTTTTACACATTTGGCAAATACTCAGAAATTAAAATACTAATTAAACTAAATTACTCATATTACAGTCTTCGGGGCGTAATACGCCGCCCCAGCGTTCGCGGACTCCCATAAA


Search Again