CR00122

CRIMIC CR00122

Gene CG1358

CG1358

Information

Donor HA-L PCR HA-R PCR Stock number
pM36 no band short band79228

Images

Construct Sequences

sgRNA sequence
AGTGATAGCCATTTAATACGAGG

Amplicon 5' Amplicon 3'
CGTCGGGCGTAGACTTTGTAGCCTAAGAAATAGAAAGTGGAAATTGAATGCCAGCCAGGTGAAAGCCACTTCAGAGTGCTCATGACGCGGCCCAAGGCTCCCCATTCCATCGCATCGCATCCGACCATCCTGCGGAGGAGGACCCCGTGTAGAGCTGCACCGGATTAACTGGATCAGGGGCCGGGATTACATATACTACTCACTACTTCTTCACTACTTCCACTCGCGCCTAAGGCCTTTTCCGAAGCTAATATCCATGCAAATGATGGCGCCCACCACCATCGCCCCATTATCGTAACAAGTTAATCCGCCCTTTCTGTTTGCCTAGTGACGTCGCGGCCTTGAGGGTTTTTCGGTACTTCTCTAAATTTCCAACTTAAAGGCCTCCAATGGCAATCTTGTTAGTCATACTAGCCAGCTTATGTCTCTAAATTTATATGGTATTATCATTATCCATAATAACGTTTGAAGTTATACAAAATTTCAATTTATTGAGTAATTTAAATAATTTTGTTTTGCTGCAATTATTTTGTTTTGAATATATATTTAATGTGTGATTCGTGAGCAAAATATCCTGAATAAGATGAAATTAGGCCCCATGAGGTTATCCTTTGGAAAAGGTTTCCTCGAAATTTGAAATTATTGGTCGACTTGTTTAAATAGCTTAATTATTTTCGATTCATGGACACCGTGATTTTCGCTAACGAGGTTCATTTAAGCAACTATTTTTGCTTTGACCTAAATCGAATTTGAATAAATTTCTGTTCAAATGGAGAGGAAATCCTTGGCTTTAAAGGCATTTTTGATTCGGCCATTTGTGGGAACGTTCAATTGTCCCAGGAGATCCTTATGATTAAAATGTTTGATTACAAATAGAACGGGTGTGATCTAAATGCACAGCTATTGAAATGCATTTAGTTTGCACCTCGTATTAAATGGCT TCACTATGGAATCGCGTGCATCGGATTGCTTATATATGTATGTAGTATATATGTAGGCTTTGGTTCTATTTTTAACCATCTTTCTCGTTCCAATTTGTGACAATTCACAGGCGACGTCACTAACTTTTCGGCTTGCATGGCATTGAAAGTACAAAACGCTTTGATGCCCTGCTTTATTTGTATTTTTCAGTTTTCAGTTAAAGCACGTGTATGCACAAACACAGCCAGGTACAATGGCCACACATATGTTTACAGTGCACAGGAAGAAAAATAGGGTATTACTATTAAAAAAATAATTATTTAAGATGGCCCAGTGATGTAATTAAAATATATAGATGAACTTCTTCAGGTTCACAGAAGAGTTACAAAGTTCGATTTTGTATAAAATACATTTGCTTATGTAGATCTTGTATTTTTAGTTCATAGTTAATCAAAGGTGAATCTTTTTTCTTGCAGTGCTTGCGGCTGGCCTGCTTTTAAGTGAATGTGCGGCTGTGGCTTTGGTTTTGGCAGGCTCGCCGAGTGCATTTGTGTGTGGTGGTTGTGTGGTGCCTGGATTGCATACTGCACCCGAATGCCAGCTCTTCGCACACCCACACTCTTACACACCCGCACCACGCACCCATACATCTATGCAGCCGCAACACAATCACAGACACGATACTATTGCCTACCTGGAGGCGCAGTTAGGCCAAACCGCTCGTTCGCGTCCGACATGCAAAGTGCAGGTGCACATTCAGCTGCAGCGGCAAGGCAACTGCGCGACTGTTCGGCTTGAAATGCCAACTAGGCGAGTGCTGTGT


Search Again