CR00118

CRIMIC CR00118

Gene sws

CG2212

Information

Donor HA-L PCR HA-R PCR Stock number
pM36 OK no bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
GCCATAGGACTGAGATGCTGCGG

Amplicon 5' Amplicon 3'
CACATAGCCCACGTCTCGAATTTCGTCGAAGCTGCCGAAGGCTAGAGTCTTGTACTTATCGATCGGCGGTCGGATATACTCGCAGTAGTCGGAGTTTTTGACCTCCTGCAGAAAAAAATATGTTAATTGCGTTTTAAGTTCGATTTCATGGAATAACGTATGTACCTCTAGTTGGCGTACGCAGGACACATAGGCTAGTCGGGATTGGATGTCCGGCAAGTCGGGCACCTTCACAGGCGATGTGAAGGGATTCCATTTCTTGTAGAGCAGCCACCAACCGCTTAGGTCGTCGCCATAGTTGGTCAGGTCAGTGTCATCCTGGGATCCCACATCGATGGCGATTATGTGAGCAGCTCCAAGATTATGCATCACATCGGCTAAATGGTGGCCAAGGAAATAAAATGGCCAGCATGCGGGTGGTGATTTAGTTGGTCGATGTGTAGGATATGTTGTGAATGCAATACAAATGTTCAATTAGTTGTGCTTATTGGTTTTACGGTATTGAAAAACTAATTTAACAAATTGCGCTTACAATTTAGTTTTAATATATTGTAATCATTTTTAATTGAAAACAATTTTCAAAATTGATTAAATTCACATTGTAAACGCATTTGATTAATCTTATCCCGCAGCATCTCAGTCCTAT TGGCCAAGTCAATCATTTGTGATATCTGCGTATATCGTAAATTTTTAATTCGAGAGTAGAATGTGTGGATAATTTGATTGAAACTGGATTGGGCATTGGAATAAGATGCTGGGAGACGAGCATCGCGAATTTCCAAAACTGGAACGGACGCAGGGGGCGGCGCAGAGCGTTGGAATCAGGATCGTGCATCGCCAATATGGATGGTGTTTCATTTTTTTTTTTTTTACCTGGCACGTTGTTCGTGTAGCAGCCATCGAGCAGGAGGTGGCCGTCGCGGTAATCACAAAATGGTGGGAAGACGCCGGCAATCGACATGCTGGCGCGGCAGTACCGCCACAGGTGGCCTGTTTTTGTTTTTTTATCACAGGTCGGACAAAACAACAACAGCACAATATTGTGGATCGTATTTTTTGTGGATGACACGGAAACACGTGGGGGATTGCATTGGTTTATTCAATTGGTTTGTGTGTGTGTGTGAGAGAGACAGGTCGCGTGTGTCAAAGATAAAGATAGAGAGAGGGAGAGAGAGAAAGATACACACTTTTATCCACGAAATAATGGTTTTTTTTAGTGCTAAAGCTACATATGAAATTGGTCTTATTTATACGCAAACAACAACAAAATGGTCAAGGCGAACAATTGGGGAACAAATAAACTAATAAGCAACTCAAAATACCACAAAAAAAAACTAAAATAGGTAGAGGATAAACCAAAGAAACTTTGTGCACTCAATTATAGTTGTGATTCGGTAATTATGTATAGGTATGCGTGTGCGTGTTCGGTGTGTTTACGTGGAAGGGAGTGAGACAGATGGTGCAAACGAATGCTCTTTACCGTTAGAAATGCAGGCCACGCAAACTATCGATTGGCAGCACTGGCATTGCCAGCGCGAAAAACTTTCAAACTCTCAAACATTTAAAACATCTTGTAGAACAAGAACAACAAATATAACATCATCTCATGGATTTGCCGGGAAAGAGGGACCAAAAACGGAACGGAGCGAAGCAAACGGAATGGAACGTGAGGAACGTAGAACGCAGGCAAGCATGATCGAAC


Search Again