CR00111

CRIMIC CR00111

Gene Acer

CG10593

Information

Donor HA-L PCR HA-R PCR Stock number
pM36 OK no bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
CACCACAGATAAATGTCAAGTGG

Amplicon 5' Amplicon 3'
GTAGATTGGCAGGCAGGTGTAAAATTTCGGAACACGCACACTCTTGTGATTGTGTATGAATGCGAAACGGCGTACGCTCTCGCAAACGCTCCTACGAGTATAAAAACCGTTCTCCGTCGCAGCAAGCAGTCAGTATCTCCACAGCAGCAGAGGCGACGGGAAGACAAAGCAATCTGAATTGAATACGTCCTAGTTTTGGGTCCGTATAACAAAAAAATTTATAGTGCAAAGTAGCTGAGATAAGCGCGGCTTGACCCGGGAAAGGCGCCAGAGATGGGGGCATGCAATATAACAGTCTTATTGCTGGTCATCATGTTGTGGGTGAGTTATATACGAACACAAGCCGCAAAGATTTCGATTATGTTCTATATTTAAACATTTGTATATATTTCATTAGCTACCCCATGGTCTGTCCATGGGCAATAGCTGCTCGGCATCGGTGCTGGAGGCGCGTAGGTTCTTCGAGCTGGAAAATGAACAATTGCGAAGGCGTTTCCATGAGGAATTCCTTTCCGGCTACAACTATAACACCAATGTAACGGAGGCGAATCGCCAGGCCATGATCGAAGTGTATGCCCGCAATGCGGAACTGAATAAGCGACTCGCGCAGCAGATAAAGTCCTCCGATTACGTTCAGTCCGAGGATGCGGATATACGACGACAGGCCGAGCACCTATCCAAATTGGGTGCATCCGCTCTGAATGCCGACGACTACCTGGCCCTGCAGAATGCCATCAGTTCGATGCAGACGAACTATGCTACCGCCACCGTGTGCTCGTACACCAATCGCAGTGATTGCTCTCTCACCCTGGAGCCGCACATACAGGAGCGTCTGTCCCATAGCCGTGATCCTGCCGAACTGGCTTGGTATTGGCGGGAGTGGCACGATAAGTCCGGAACTCCCATGCGGCAGAACTTCGCCGAGTATGTGCGACTGACGCGCAAGGCATCTCAGTTGAATGGTAAGTGATGGACGCCTAGATAACCCCATGTCTGACCCAAATCGGGAGAAATCGGTTCGGCCAGCACAGGGAGAAATA TCCACTTGACATTTATCTGTGGTGAAGTACTTGGGTATTTATACCTAATTTCGGTGCACTTTACAATATCGTGATATAAGGAAGTTAGGGTGATCCAACTTTAAGAAGAAAAAATTATACTTATGCGACGAAACTCCACAAACATAACAGTTTTATACCATTATCTCACTAATATTAAAACTTATATTAGTTCTAAATATAATTTACTACCAACTGTCTGGCAATAGTTTTGTATACAATAGTATTTTCTAATATTAGGTTAATAGGGGTTATCACTTTTTCAGACTTTGCAAAACTTAGTTTTTTTTTTTTTTACAAATTCTTTCGATTTAATATTAATAGAATTCATATTATAAATCATGCTTATAATGTAATATTTCTGTCTACTTAAAGGTCACCGCTCCTATGCCGACTACTGGGTGCAGTTCTACGAGGACCCGGACTTTGAGCGACAACTGGATGCCACTTTTAAGCAGCTGCTGCCCTTCTACCGACAGCTCCACGGCTACGTTCGCTTTCGTTTGCGGCAGCACTACGGTCCGGATGTGATGCCAGCGGAGGGAAACATACCCATAAGCCTGCTGGGCAACATGTGGGGTCAGTCGTGGAACGAGCTGCTCGATTTGTTTACTCCGTATCCGGAGAAGCCGTTTGTGGACGTGAAGGCCGAAATGGAGAAGCA


Search Again