CR00108

CRIMIC CR00108

Gene Shmt

CG3011

Information

Donor HA-L PCR HA-R PCR Stock number
pM36 OK short bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
AGATCACCTTATTGGCTCTATGG

Amplicon 5' Amplicon 3'
CGGGCACAGTGTTCTTGTTGCACGCGATGCCCACCTCCTCGAGGATGTACTCGGCCTTGGCGCCGGTCAGGCCAGCCTTACGCACATCGACCAGCACCAAATGGACGTCGGTGCCGCCGGTGGCCACCTGATAGCCTCGCGAAATGAGGCCATCGCACAGGGCCTTGGCATTCTTGAGCACCTGCGTCTGGTAGGCCTTGAATTCGGGACTCTTGGCCTGCTTGAAGGCGGTGGCAATGCCAGCCACGGCGTTGTTGTGCGGACCACCCTGGAGTGATGGAAACACCGCCTGGTTGATGCGCTCCTCCAGATCGTAGAGTACCTTGTCTCCATTGGCCTTGGTGCTGCGCACGCCCTTGCGGAAGAAGATCACGCCGGCGCGCGGACCTCGCAGTGTCTTGTGCGTGGTGGTGGTCACAATGTCGGCCCATTCGAACGGCGATGGTATCAATCCCGCGGCCACAATGCCCGCCACATGGGCCATGTCGGCCATCAGGTAGGCGCCCACATCATCGCAAATCTGTCGGAAACGCGCATAGTCCAGCAGACGGGAGTAGCACGATATGCCAGCAATGATGATCTGCGGCCGGAAATTCTTCGCCGCCTCCGCCAACTTATCGTAATCGATGATGCCCGTCTCCGGGTTCACTTTGTACGGCATGCTCTCGAAGAAGATCGATGTGGCCGATATCTTCTTGGTGGGCGTGAAGAAACCGTGCGTCAAGTGACCGCCATCGGGCAGATCCAGGCCCATGATGCGATCGTGGGGCCGGCAGACGCCCGTGTAGACAGCCAGATTGGCCGGGGATCCGGAATAAGGCTGCACATTAACGCCCCACTTCTCATCGTCCAGGTTGAACAGCTCGCGTCCGCGTTGCTGGGCGAGCAGCTCTATGCGGTCGATGTACTCGTTGCCACCGTAGTACCTGCAAGTCAAAGCGATGACCAGGATTAGAGCAGGATCACCAGGGATTCACATGCC TGCCATAGAGCCAATAAGGTGATCTCTACCAGTAAGTATGATATCAGAACTAGTATAGAATCATTTAAAGATCCGACTATGATGTCTTCTTGCAGATCCGTGAGGAATCTTATATGTGCACCCACCTCTTGCCGGGATATCCCTCGGAGTACTTGTTGGTCAGGCAGGAGCTCAGGCTCTCGAGAACCGCCACCGAGGTGAAGTTCTCACTGGCGATCATCTCGAGTCCTTCGCGCTGGCGCTCCTTCTCCTTCTTGATCAGCTCGGCCAGCTCCGGATCGCCCTGTGCCAGCGGGGTTTGCAGCAGTTTCTGATCGGCCATATTCTGTTCGGATTTATATAGTATTGTATATTATATATATATATATATAGTAATTGGAATGCTGTGCAATGTGCGATGCGCTCGCCAAGACGATCGTTGAATATGTGCGGACCGTGGAAAATGAACGGCTGCCTGGTCAGCTTTATGCCATGTTTTTAATAACGCTTCGAAACAAAAATAATATTTATGTTCCCGCCGCCGATGGTTGCGAAAAGTTACAAACAAATACGGGTTCAATGGGTTCAAATAGCATTGGAAAAGTTCCGGCGATAAGGCGCAGCTATCGCCAAGGCGAAGATTACGCCTGGATGCACCATGGCAACCACTCGAGAGGCGCTCCCCCGATTCCCTATTCCCGATCCACGATTAGATTGGCCAAATACCAGGGAAACCAAGTGACTTGGGTGCAATAACACGCCCATGATCGAAAATGCGACCCCCCATGGATGGGAGAGCGCGTCTATTTGCGATCCGCTTATCGTCAAGTGATTATCATCCGTCTGGGTCACCAGTTCAAGTCG


Search Again