CR00090

CRIMIC CR00090

Gene CG3270

CG3270

Information

Donor HA-L PCR HA-R PCR Stock number
pM36 OK OK78875

Images

Construct Sequences

sgRNA sequence
TCCCTATACCTTAAAATTGAAGG

Amplicon 5' Amplicon 3'
GGAATGAAGCGAATATGCTGCCTTATGCTAAGATAATATTATACAGTTTCTATACCTAGGACAATAAACAATACTTTGTGGGTTCCCTTATCAGTTGAAATTCGAAATCGGTGAGTTGGTGTTAGTTGTTTGTCAAATACAAATTCAATACCCAGAAATTAAAATATAGCTGATAATGTGTGCTAAAGCATCTATTAAATGTGGACAGTAAGTACCAATGCAGAACAAACCGTTTATTTGATATTTTAGGTCAGAAAAATTAGATTGTTCTTATTCACAGCGATTGAACCAAATTTTAATTATTTATCAAGAACTACAAAATAAAAATTGTGTCGAATGTGATGTTTAAATCCTTTACTCATGGGATATGATTGAAAAAGGATGTTTCCAGCCCAAATTAGCAGATCAGTCCGCCGAAGGAACTTTTACTGTAATTCCGCATTCATTGCTGTGCACACAAAGCACTTAGGAAAAGCTGCACAAATCTAATCTGGCGGATTTCAATGGCGTTATCATCCCACGAATGTGCAGGTGCCGGTGCTGGTTAGTGTGAAAAATGCTGGGCCTGCGACGAGTTCTGCGATTGGGTGCACTGCGTCAGCTTCGCTCGTTAAGTGGCAAGCCGCAAGGCGATGTCCTTCCCGGGAGCTGCGGAGTCCTGATAATAGGTGGCGGTGGCATGGGCGCCTCCTCCGCTTTCTGGCTGAAGTCCCGGGCCCTGCAGCTGGGCCGCAAGCTCAATGTGCTGGTGGTGGAGCGCGATGCTGGTGTAAGTACAAGGTGGCCTAAAATACGACACAGAGTTATTCAAAAAGTATCAACAATATCTTACAATTTTTGTAGGAACACCTT GGAACACCTTCAATTTTAAGGTATAGGGATCCAAAATTTACCCCAATAATGTTTGAACCTTTGGTTTCAAAACGGTTAAAAATAATTATGTAGTTGCTTTGCTCTGATCATATATCCAATATCCAATATCTACCAATTTAATACTTTTCCTATTGTATTAAAAATTATTATTTATTCGGTATCTAACTGAAACTTATTCGCTATTGAATAACAACAATTTTTATACAATTTTCCAGTACACCAGCGCATCTACAGTGCTTTCTGTAGGCGGAGTGCGGCAGCAGTTCTCTTTGGCCGAGAACATAGAGATGTCGCTCTTCGGATACAACTTCGTGGTTAACGGCAGGGAGCATCTGGGCGACGTGGATCTGTGCTACCAGCCGAACGGCTACCTGATCCTTGCCTCCGAGAAGGGAGCCCACATCCTAGCAAAGAACTCAAAGCTACAGAACGAGCTGGGGGCCCGAAATGAGCTGCTAGGCCCGGAGGCACTGCGTCAGCGGTTTCCGTGGTTGTCCACAGAGGGCGTGGAGCTGGGATGCCACGGGATTGACAAGGAGGGATGGTTTGATCCGTGGGCCCTGCTCATGGGCTACAAGAAGAAGGCCCGTGCATTGGGGGCGAATTTCGCGAACGGTTCGGTAGTGGGTTTTGAGTGGAACGATTCGGGCGGCCTTTCTGGAGCTGTGGTCGACGCCGGAGATGTGTTGCAGCGCACGGTGAAGTTTGACACGTGCGTTCTGGCAGCGGGAGCGTACTCGGGTCAGGTGGCGCGTCTGGCAGGGATTGGTGATAAGGAAGCAAAGGAGGCTTCCCTGAGTGTAGCCCTGCCGGTGGAGCCTCGCAAGCGATACGTCTATGTGGTTAGCACTCAGGGTAAGAATTGTCCTGGGCTAGCCACACCTCTGACCGTTGATCCCGATGGCACCTACTTCAGGCGGGACGGTCTTTGCGGCAACTTCCTGTGCGGCCGCAGTCCAAACGAAGACGAGGAGCCGGAGTGCGAAACGCTGGACGTGGACCACGGGTACTTTGAAACGGATGTCTGGCCCACACTGGCGAACCGAGTTCCTGCTTTTGAGTCTGTGAAGA


Search Again