CR00083

CRIMIC CR00083

Gene Sec23

CG1250

Information

Donor HA-L PCR HA-R PCR Stock number
pM36 OK OK78874

Images

Construct Sequences

sgRNA sequence
AAGGGATACAAGCACCTAGAAGG

Amplicon 5' Amplicon 3'
GCAGACGCACAACAACATGTACGCCTACGGGCAGGTGAGTCTCGCAGCCAGCGCCATCAACTGGCCACATTTGATTGATCTTTGCAGCGCTCCATTTGGCGTCATCGAAAATTTAATCTCAATCGAAATCTCAATCTCGTTTTATGTTGGTTTTGTTTCTCTCATTGTATAATCCGTACCCGTATCCGTAACCGCTCCTTTGTCAATCGCAGGCGCCCATCGGTCAAGTCACGGTAGTACATATTTGTTTAATTTTCAACTTTTAAACTGGTGGAAAGGTGGATATTTGAAATTTAAGGGGCGGGTAAAAAATCTTTGGAAATTGGATATGTCCTTTGCTCTTGATAGCTATAAGTCCAAAATAAGTGTTTTGGATTTTGCAATAAATCTAAGATGGCCAACCCCACACGGCTTAATCTAAGCAAAGATTTTGTCTGTTCCTATTTTTTCATATTGTTTTTAATAATTTCAAACATGATTTATATATAAGTGGCTTTTGGTGTTGGACC GGACCCTTCTAGGTGCTTGTATCCCTTTTTCATTCATCCTCCCCTCCCCACTTGGCACGATCCCACCCACCCATCGCATGACTAATTTTCCGGACATTATCTCGACAGGATGGCGGGGCTCCAGTGCTCACGGATGACGTTTCGCTGCAGCTGTTCATGGAGCACCTCAAGAAGCTGGCTGTGTCCACCACCACATAAATCGACTCTGGCTCTAGTTTCAGGCGCTTGCTTCCCTGGCGAAGTCGAAGAAGGCGAACGACACCTGGAATCAATGGTCCAGGCAATGAAATTACGAATATACAACCACTTATTCCAATTGATCGTCTTATAACGCAATAAACTATTCAAATTATGTTCAACAATAAGTGTGTTAATCCGCGATGCTTTTATTCGTAAGCAGCTGAATTAGAATTTACGTTGAGCGGAATGAGTTTGTAATTATAAAAACAAGGCATTAACAAAATGAAATGAGCATCTCTTTCATTCTTCATAACAACTATTAATACAAGTAAATCCGACGGGTTCCTGAAACCTACAAGATTTGTAAAAATTATTTTTTTGTAATATAAGACAGCAAAAGATTTATTTATATTTTTATCATAAATATTTGATCAAATTTCCGGACGCATTTAACTTTTAGATACCAAGCAATTGGTTATATTTTTCTGTATTTCTCTAGCACCCGTGATCAAACATATGCATTTTTTGTTTAACTTGAATGAAATATCTTCGATAAGCTTTGGGCAAATTACTCAGGTTTAAAAAACTTTGCGACACTTTCATTTTCATTCATTAAATTGAAACTTCTAAATGGTTGGAAAACACAACTGGTATAATAAGAATAGCAACCACTGCTTTCAAATCATTAGAGTTTTCAGTAACCCGCCGGAATGCCTCTCGACTAACTGCATCCTAAACTATTTGGTACACACTGACTAAGAAGGTCGCTCTTTCCTCGTGATTGCCGCATCCAGCTAGCCTAGTTGAGAAACCGTATGGACATCTTCTGATCCACGTCGGTGCGGTCCAGAGCTTTGCAGAAGTCCTCGAACGAGATCTTGCCCTGGCAGCACAGGTCCGCCTCCAGGATCGTCCTCTCCGCAATGCTGACCAACTGGTCCTGGCTAATGTTCGCCCCGACCATCATGTGCAGGATGGAGAGCAGCTCGTCTCTGCTGATCACA


Search Again