CR00071

CRIMIC CR00071

Gene pyd3

CG3027

Information

Donor HA-L PCR HA-R PCR Stock number
pM36 OK short bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
CTCGTAGTAAATAAGCATTACGG

Amplicon 5' Amplicon 3'
GGCGCCGTAGTAGGGATTACGATAGAGTTTTGGATGGCGCCAACTCTGACTATCCGGCGCTTGCGAGTTTGCTCCTCTCGCGCCGTGAAGCGATAGCCCTTGATGTCGAATCCATTCTGTTCGGCAATATCTTTCGCACTTGTGGGCAGCTCAAGCGTTTGACTGCCAAGTAAAATTATATTATACCGCGATTTAATACAATACTTTGTGTATAAAGCTTAAATAATTATTTTTAATTTATTATCTTTATGGACAGATGTTCCTAATTATGGCTATATATTTATTGACCATTTTGACCCCAATAAAATTTTTGTGATCCTTACTGTGTGGTCAGAAGCTTATCTGTATTTCTGATAGTCGGAAAATATGGAGTGATTAGACTGACAACACAAAGTAAAGGAAAAATGGAATAACTAATTATGTTCTATAATTTTGTTCACATCACAATGGTTTTATAGTTTTCTAACACAGATAAAACCAATATACTGATAAAAATATATCCAATTTTTTATTTTTATTTTGCTTGCTTCGGCTTCGTGATCGTTTCACTTTCATCACCAGATGTTCTCAAGGGTATATATGTTAATGTGTAGATGCAAACGTAGCTCTGTCAAAGCAAGTTCTTTATTGCAATGTAATACAATGTAACCCACTCGTAGTAA ACGGGCAACTTAAGGTAGCAATGAAATGCTTTTGTATGCTCCCCTTCTGTTTGCGAAAAGATTAAGATTAAAACATTTTTAGAATAATCTGGAGGTTTTATAGGCACCCACCCCCACATGATGTTCTTACTTGATTTTAATGGTCTTTTAACTGTACTCACTCTTCTTCTACGCCGTACAAAATTCTCTTAACCTCCTTTAGTTCATCGGGTGGTAAATGCTTTTCCAAGCAATCATTTAAATTTTTCAGTTCAAATGCTGACATTTTTCCAATTTTACAGCAACAAAATATCTCATCAATTATCGGACTCAATTGATAGAACAACCTTCTCCGACCACCGCAGTATATGAAATGAGTCTGCTGACGATCGGATTCTCATCTTATCTACACTTCTCTATTTTCGTCTCTCTCTCTCTTGGGTTTCTCTCGGCATCTCTCCCAAGTGTTATAAAAATAGTGAAAAACACATACATATTTAAGCACACTCGCTGGCATTTGAATAGCATACGAAATGAAATCTCACCGACAAAGCATATACTGAAAATTACGTGTGTAGTGTTGGGATTATTCTTAATTGTGTATATAAATAGAAATAAAGAAATAATTTTATATCATTTTCTTTTTTAATTTATGATCATTTTAAAATTACTTTCAAAATAACAGTTATCTGATAGTCGAGGGTGTCGACTATAGCAAGGTCTCTCGTTACATGTTCAATTTATTTATTTATTTTCTTGCAATATATACAGATAAACAACAACAGTAATAACATTGAAACCGGCATTTTATAATCCAGCAATCTACAAATATCACAAAAATAAACCTTCTGAGACCATACTTGACGATTTGAATTTCAAAGATCTGTCGTCAATTTAAACTTGAGAAAAGTTTTCTGTAAGTAATAAAAACTTATCATTTCTGGTGAGAAAAGAAATTTTATAAATTGTTTCTGCTGGCAAATTTAGTTTGATAGGTCACATTTCGGTCGATATTATTCAAATTTCATGCTAGGCTCTAAATCAAAAATATCTTAAGACCTCTCCTTAAAATGCAGATAAGTCCCGCGTGAGCTGATTTTGTCAAACTTAAGTAAATATTGAGCGGGTTCGGCGCATATCCTT


Search Again