CR00064

CRIMIC CR00064

Gene Pfk

CG4001

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 OK OK78873

Images

Construct Sequences

sgRNA sequence
CCGATTGGAGATTATCTAACTGG

Amplicon 5' Amplicon 3'
CCCGAATTTCCCCATTCCCAGCGGTGAAAGCTCGCGAAAGCTTTTACTCGCCCAGTGATAACCAGCTGATCAACAGCTGAACGATTGTGGGTCGAACATAAACAAATTGGTTAAACGCTATTTTCCGCTCGTTGCTAGTCGCGAAAAGTCCGTTCATAACAGACAGAATCCTCAGATTTTCGACCTAAATCAAACCAAGTTAGGGCAATCGCGTTGGAGCGAACTCTTGGGCGGATTTAGCCATCCGAAGTTTGCATTGCATCAGTACGCACTTACAGAAAGCCCGTGGCTGTGTGCGTGTGTCCGTGTGTGTTGTGTATGCGTCTCTGGCCTGAAGGTCACCTTGAAACGTCAAAAGCAAAAGCGAAACTTGTGAATACCGCCTGCGAGCGTACATATTGCTAGTAACTGAAAAGCCACGGCAAGGAGCAGTAGTAGTATTTATAGCCCACTTGGATATAACCCAGCTCCAGCGGCGCTGCTCGCATAGTTGCAAAACAGGGAAACTCCCTACCGAGTACAATAGTGGTTCATAGTGTGTGCTTTGTGCGATATCCGTTACGACCCCAGTTTGATTTACATATAGTGCAAAAGATTGAAAAATGAATTCCGAGATTAATCAACGATTCCTGGCCCGCGGCTCGCAGAAGGACAAAGGACTGGCGGTCTTCACCAGCGGCGGGGATTCCCAGGGCATGAATGCCGCCGTGCGAGCCTGTGTCCGTATGGCCATCTATTTGGGCTGCAAGGTGAGTTGGTGACCTCTGTCAAGTACTTTCCGCCCACGCAGCATCGCGTCCGGTGACCCCGACCCCCAGGCACAGGCAACAAACCCATGTGAACCCAGAAATTTACGTAAAACACCTGGTAATTTGCTTATCAGCAGCCGTTAAACCACGACTATTGGGCCG TCTCCAATCGGTGCGAAAAGAAATTCAAGAATATATGTGTACATGCACATTGACATTGGGTTTATTTTCGGGTCCCTCACATGCGATTTCGATTTCGGCTAATTTGTTTCGTTTTTTTGTTGTCGCTCTTGGTTTCTATTCGGTTTATTTAAATGAGTTCTTTAATTTGTTAGGGAACTTCTGGCCGGCCGTTGGTCCCTCGAAAATATGCAAAAAATGTGTCAATTGCTAGCCAATTTAAATTGATTAAAATCTATTCATTTGATTTCAATTTCTTGGGGGTCAATAAAAGTAAAGTTATTGCCACGCTTTGCATGACAGCGCTTGATATGTTCAATAAATTGAACAAAATTAATAAATATATCATGAGTATGCTAAACAAATGGTTCCAAATCAGTTCAAGTAATCTAACCTTTGTTTTTAATCTACTAGTGCCTTGGCATCATTATTGTTTATGTTATTTTTTCACTTTTCAAATTAAGAGCGTTATAAAATTTGAATTCTTGGTTATGTGAGTTGCTTAAAAAGTATCGATTTAACATCGATTACATTGTAATTACCTGTAACGGTATTTTGAATATGCAAATGTTTTGTTGTTTAAAACTTAAACTTATTCAGTAAAAGTTGAGAAAGTATATGAGATAAGTCATATCATATTAATTTCTATTGACTGTTCTTTACTGCTTCCTATTAAAATATTACGACTTTGGCAGAGTGAAAATGAAATTAAAATAATTTATACTCGAATTCGGTGATTCATTTTTAATTGTGCTAATGATGTCATGTGCCATGAAGATACCAAACTCTATACCAAACTGTTTTACACCATATCTACAATTGATTCGTGTTTACCTTCGGCAAGGTCTACTTCATTCGTGAAGGCTACCAGGGCATGGTGGATGGTGGCGACTGCATCCAGGAAGCCAACTGGGCCTCAGTCTCATCCATTATCCATCGTGGTGGCACCATCATTGGCTCCGCCCGTTGCCAGGACTTCCGTGAGCGTCAGGGTCGCTTGAAAGCCGCTAACAACCTGATTCAGCGAGGAATCACCAATCTGGTGGTCATTGGAGGCGATGGCTCCCTCACGGGCGCCAATCTGTTCCGTCAGGAGTGGTC


Search Again