CR00060

CRIMIC CR00060

Gene CG15111

CG15111

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 OK OK78872

Images

Construct Sequences

sgRNA sequence
AGGCAAAGCGGATTAATATACGG

Amplicon 5' Amplicon 3'
TCAAAGGTCGCTATCCGGAGGAGGAGCTATCGGGTCCGGTTCGGTCTTGCATGCGTCCCATCTGATTAATCCGTCCAGCAAAATAAAAAACAAAAAAAAAAAAAACCAGAACAAATCAAAACAATCTGAATTAACCAACAAACTTATTTATCTCTCTTTTCGCCCGGGAAAGCTACGCACACAAAAACGCACAACATCAGTAACATTCAGTGTTAAGTCGCTTTCCCCGATAGAAAGTTATATCGCTAACTATATATTAAGACGATAAATACAGAACGGACGTAAAACATTCACAATGTACGAGATTCATAATTGCCTAAGGTCCGTTTTCTTAGCCACACTCATTCCCGGAACGATCCTACTTAGTTGGCTAACTGGTCTGTAAGTATCCACGCTCGATTCGATGTTGTGCGCTTGTTTTTTACTACTTTCGTAGACATAACCCGAAACCCATTCTTCTGATTTATAATCCGAACATCGTGACATCGACATTTCTCTTTCGCGGCTAATTTCGCCGGCTCTGTTCCGATTCCGCTTTTCCGTATATTAATCCGCTTTGCCTGCA TGCCTGCAAACCCAATTGTATATACACATTATCCCCTGATCCCTGACGCTCACATCCGCACCAGCTTGCTTGTCCTTTATGTTCTTTTGTCACTTAACTCTGTTGTTAGTCCCATCCTCTTAGCCACCCAGTTACCGTTCACCTCTCACCAATTGACATTTCTCGCAGGGTGGGTCTGCGATGTCTGCAAGCTTGTCTGCTGATCTTCTTCCTGATCTTCGTGGTCCTACCGTTGATCTTTCGGTATTCCGTAACGTTCCAGCGTGGCATCCTATTTCTGACATTTAGTAAGTATCCAGATAACCGTGGAAGTTTCATTTGTTCAATATTAATCGAATTTCTCGTATTAGTTAAGTATCCCAAAGGACTTGATCTCACCAAGCCGGAAAGCGTGGGTCTTTATGCCACACGAAACTTCTACATAACCGTAAAGGATCACGATCAGGACGAGGATGGAGTGCGAGTTGGTGTGTGGCACGTGCTGCCCAGCAATGCAGTGCGTCGTTTTAAGCGCGAACTGCGCGTGGAGGAGGAAGTGGCCCAGGACCCGGATCAGCAGCTGGATCCTGCACCTGGCAACGAACGCGAGCTGAAGGAGCTATCGCCAGCCATACGATCTGAA


Search Again