CR00050

CRIMIC CR00050

Gene gig

CG6975

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 OK OK78871

Images

Construct Sequences

sgRNA sequence
CTGGGAGCCCACCTTGAAGTAGG

Amplicon 5' Amplicon 3'
CAGGCTCCGGGTACACAAATCATGAGCTTCTTGCTAAAATGGTACTCCGCCGGACAGTTGAACTCCTGGAAGGGCATGTCATCGTCGCCAGTGCAAACATAGAACCTTTGGCAGTGGTCTTTGTGGGGCAGCATTTGCCAGGGATCGGATATCCTGCAGATAGCGGATATATCTGTAAGTTCGGCCTTAACCAATGCCGTGGCGATGGCAAGAAGCAGCCATATAACTAATAAGCGATCTGGAAAAAACGAGAACTCTTTAATCACCCTAAAATAAGGTACTCTTATTACACTCACTCTCCATTTTCGTCAGATGCGCGTTTATGCTGGGAATCCGTCGAATGCGGCGTTGATTGCTAATGACTTGGCTTTTTATGTCTTCGCTTTGATTGAATTTTTTCAGCCCATTTGGCAATCGCTGGCAGAGATTGCTCCGACATTTGTTTTTTAATACTAATGAGTATTCTGCTCAGTCTTTATCTGCTCAATATTTCCACCACTTATCGAGGGTTCCGCTGACTTCAGCACTTCTTATCATTCAACATGTTCCAGCCGATGATGATTAACCCTATTCCCGAAATAAGAAGTGATCATTGAATCTGTGGCCCCCCGGTGGAAAAAGTGTATTCAAGGCCCATTCGATACCGACGATAAATGAGTGGGTCGCTGACCCAGTTCCCTTTAAGTGACCTTAGTACAAGTTTACAGAGTAGATTTTACAAAATCAATGATTATAAATCCATGGGCTTAAGTATAGTAACAACCAATCAGATCTTTGGGCATACACCGCAGCACATCGAATCCGTTTCCCGTCAACTTCAGAGACGACGCCCGGGTTCCGTACTCGATGGCATCCCTCAGCCGCATCTTGACCTTAATCAGTGCATATATCACGGCCGCCGAGAAGGTGTCGTTAACGGCCACAACGTCCACTAATTTGGGCGGAATCTGGGAG TAGGTGTCGTCGGCCATCAGGCAACTGGCGCCTTCCATATAATTATTGTATATGACGACGGGTTGGTTATTCAGCGGTCCCGGGCAATATCCGTTGGAATGCTCATCTGGGGGATCAGGAGGTAGATAGGGCATCTTTTTGGGCTGGCTTTTTTCCCATTGAGTCCGTGCTCTTCGCATTTCATTCCTAATCGCCCAAACAACCTCGCGTCCATTCATAAAACAGTACGTACGCATCATGGTCTTTCGGGCGAAGACGTAGTCCACCATACTGGCCATCAACATGGTGGCCGGTCGCAAGTTGTCCAGATCCACAGAGAGTGTGATCCTTGACTCGGGGCAGCGCTCGTTGAATTGTATGACCGCCAGGACCATGCGCAGCATCTCAACGGGATTACGACATTCGAAGTGTATCCACGAGTACTTCTGGTAGTCCACGGCGCCCACAAACTGCTGGTAGGTGAGCTCCTGGTTGGCATTGGCGAACTCGAGCATGGTTCGCGTATCCA


Search Again