CR00049

CRIMIC CR00049

Gene Sar1

CG7073

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 OK OK78870

Images

Construct Sequences

sgRNA sequence
AAGCGCAAGTCACTGATATCAGG

Amplicon 5' Amplicon 3'
CCACACTCAGGGTAAGTGCCTAATCTTGACCAGAGCTCAGGGGAATGTGAATGTGCATCCAAATCGTTGCTATTTTCCGTACGTGCCCACGACTAAATATAGACCAGTATGCAAATATCGCAGGGCTAAGCAAGCGCAGCCGCCAGATCCACGACAATCAGCATGAAATATAGCGCATCAGGTCACCCATACAGCCAGTGCGTCTTACACTCGTAGCATTTGTTGCGATCAATCAGCGCCACACACTCGAAGCAATGCCACCACAGTGGTCACAAGCAGCTCATCCAGAGATCTCAATTATCATCTTATCTCAACTGTGATTATGAAGACCTCAGAATACTAGAATATTTAACCCATTGCATACAATCAATATGTTCATTTATGTTTAGAAAGCAATTAGTGTCTTGTTGATTTTCGCAAATACTATCTTCCTTACCACTGTGCACATATAGGCGACGTATTTATTATTAATATTATGAAGGCAAACATTCTCTATGTAGATAACAAACAGAAACGAAAAACTCGCATACATGCAGTTGATATATGTATATAAATATGAACATTATGAAAAGTGATCAAACATCGTGAAATCCAGTTGTTTTGATAACGAAGCTCTAGCACTCATTTTAAGGCAGCTCGTCATCGTGACGATCGTTTTCGCTTCGGAACTACTAGGTACACTAAAGTAGAAAGGTTCTTAGCGGCGGAAAGATATCAGATTTGTGCCTGATATCAGTGACTTGCGCTTTGT TGCGCTTTGTTATTCTAGCGATGTTATATAAATTACAGATTGTTGGTCAACAGCAGCGACTACTAAGGTGCCCTTGCAAATCTTGATTCAAAAATCGGAAGACTAACCCATCTAAAGACTAACTGCTGCTTTTGTATTTATGAGACATATCTACTTATTTCTGCAGCACGACGCGTCTGGAAGGACTACTTCCCTGCTGTGGACGCCATCGTTTTCTTAATAGACGCCTGGGACCGTGGCCGCTTCCAGGAGAGCAAAAACGAGCTGGATTCGCTGCTCACGGATGAGGCGCTGTCCAACTGCCCCGTGCTCATATTGGGCAACAAAATCGATAAGCCCGGCGCGGCTAGCGAGGATGAGCTGAGAAACGTGTTCGGACTGTATCAGCTAACAACCGGCAAGGTGAGCACCAAAACCACCTCCCTCCCTCCCTCCCTCCTTACTCCTGCTACATAATTGATATCCATTTGACTTGCAGGGCAAAGTTGCACGCGCCGATTTGCCCGGCCGTCCTCTGGAATTGTTCATGTGCTCCGTGCTGAAGCGACAGGGCTACGGCGAGGGTTTCCGTTGGCTGGCGCAGTATATCGAT


Search Again