CR00045

CRIMIC CR00045

Gene Dhc64C

CG7507

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 OK OK78869

Images

Construct Sequences

sgRNA sequence
GGCAGGTACCAGCTGTTTCCCGG

Amplicon 5' Amplicon 3'
TCTCGTAGGGAGATCCGTCCGAGAAGTTGATCAGCCGCAGCTGCGAATGGATCGACTTGTCCGCCTCCACGACCAGGCCGCGCTTGATGCAGGCCAAAGATGCCATCCGACTGTTGGTGAAGTGAACATCGTTGCTGATTTGGTAGGTTACCTGCTCCTTCTCGTCCTCGCCCTCCGCCGGCTGCTCAGAATCGTCCTCTGAAAATGAATAAGTTGGTTAACAATCGAATTTCATAATGGGCCCACCCAGTTAATACATTAAACGTATAATAAATATGGTAATAAAAAATGGTTTTTTTTATTAGCCAATTGAAATAAATCCGTTGACTTATTCGTCCATTATTGAACTTTCAAAGGAAAACTAATTCCCGTTGATTACGTTTATCATGTCTGGCTCCACATTTACCCCTCACCCACTTTCAGTGGCATTCTACTGCCCACCTGGCATTGGACTCAATGGCACGGCATTGGCATGATTTCATTATCAAGGTGTTGACCTACGGAAATTAAGCGTCCAAGGAAAAACCTTCGAAATTCGTGCGCTCAAGGCTGGACCTTGGCGATGTCATTGCTCCCGCGCTGTTGGCCCCGTTGCCAATGTCAATGTGCCGATGGCATTGCCTTCGGCCAATGTCAATGTCGCTCCCAAAGCTATTGAAGCGGCGGAAGGTGTGCGCAGCCTCCAAGGTCGTTTCCGTAAACAAACTGGTTGCTTGGCAGGTACCAGCTGTT CCGGCGAATTGCTTGTAAACAAGCAAAGCCGGCAAGCGGCAAAACAGCTGTTAGCACTTATCGCCCTGCCGCGACTTTCGACTCATAGTTATCGAAGTGAATCATATGTGCTGACGTCATGCGCAGAAACCCGTTTTTATACCCTCTAATGCAGTACACTGATTTTACAATGCAGTTGGTATTTACTAACATGAATTATTGCTATCCTTCTGATTTTACGATTAATTCTGAATGCACTTTTTAGCAATATCGTAATATAAAAAATAATCCTATTTTTGTAATTGAATTTAAATTTTAAAAACTGTATGAATTTGTGATGCTTGAAAATTTTTCATACAAGTTGCTAGTGACATGGTAAGGTATTCCAGCTTCGACTTCCAAGCCAAAAAATATTTCTTATTGGAATTCAAACATCTGCCAAATTGATTTTTAAAAAACTGGTTGCGTATTCAGCTAGCAAACCCATAAATGACTCAATGTAACCATATGGAACTAATATTTTGAACTTATAACAAAAAGATTGCCTGAAAAGCTTGCCAACTTTCTTATCTTCGCCAAAAAGACGCCATTTTGTGCAGGTACCATTTTTTCACCCTAGATTTGCCAACGGGACAGGAATT


Search Again