CR00044

CRIMIC CR00044

Gene Uba1

CG1782

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 OK short bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
AACCGAATGCGTTGAGCAAAGGG

Amplicon 5' Amplicon 3'
CGTCGTGCGTGATACTAGCTATCATGGTGGAGATCGGCTGTGTGCCATCCTGATCGTAAATGGTAAAGCTCTCGCCAAAGTCACAGAACACCTTGGCGAACAGTCCGCGCGTCTCGGCGATGATCAGAGCAATGCCATTTTCATGGGCAAACTTGGCGATCCTCTGCTGCTCCTCCCCGTCGGAGTTGGTCAGTACCACAACGCGAAACTTGCGCAGGAACTCCTCGGTAAGCGGCCCCGTGTGCGAAACGGTGCGCACATAGTTGTTTAACTCGGCCAACTGGGCGCAAGAGGCCTCCGCACGATTCTTGCCGATATCGGCTTCCGTGAGATAGAATTGCGACGACAAGTCATGGAGCTGCAAGACAAACGAATAATCATTAATATTATATATCAACGGTGATGAAATTAGCAGACGGGAGCCATGACTAACAAAGGAAAATTGGTTCTGTGCCGAGTGTACAGCAAAGACATATTTGTCATTAGAACAAAAAAGTTTTTATGATACAAGAAAACTTTAAATTGAAAGGCTATTAACTAAATAATTGATATATTACGGTTTATGAGAAACTCATAGATCTTAAGTTGAATCTTTCAGTGCATAAAACAAAACCGAATGCGTTGAGC ATGCAAACACAACGGCAGCGAGCGATGCGCATACGGTTGTCCCGCTCACACACTTTTCGCATGGCGCAGACATTTTGAGGCAAATAGAAAAAGAAGGAAAACCGAATTACACACACAAAACGAATTTTTTGCAAGCAAATAGAGATGTTAACCTAACCTTATTTCGCGCGAAGTCTATGATAAATAAATCAAATAAAAACTGAATGATTCACTAAGACCAGGGATGCCAAGTCAGCCTTTCCGGGCATTTCCCGCGTCCGCCTGGAAAATTATCGATTTTTTCTTCGCCCCACACACATACCCCACAAGTTGCTGTGTCATGCAAGGTGATCGATTTCACGCCGCCCAGAATCACATTCTTGGCTATCTCCAGGCCGAGTCCTCCAAGTCCCGACAGAAGGATATCCGAATTGGCCATCCGACGCATCGCATCGTGACCCAGGACGTACAATTGGCGCGAGTACAGCGATTCATCGATATCTCCGCCGGCGGCGGCACTGTTTCCAGCCATGTTGCTGCTTCCTTCCAGTTGTCGGTTATTAGTGCTGTTATTACTGTTATTGTTGCTGGAGCTGACGTTGTTGTTGCTGTTGCTAGTGGCGGATGCACTGGAGGAGGCTTCTTGCGATTCTATTGTGGTGGTGTTCAGGTAATTGCGCTTCTCCGGCCGCTTGCTTCCTTCCTTTTCCACTGCTGACGAGGTACTAACGTCGTCGCC


Search Again