CR00042

CRIMIC CR00042

Gene L2HGDH

CG10639

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 OK OK78868

Images

Construct Sequences

sgRNA sequence
CCAAGATCTCGACGTTCTTGCGG

Amplicon 5' Amplicon 3'
ATACCAGTGTGCGGACTGTGGAGCGCCATCACTCCCTGGCAGTAGGGTTCGATCTCCTGAATCTCGCTGCCTTCGATCATTCGCAGATCCGGTACGTTGTTGGCAATGCCACGCTTCTCCAAATCCTTCAGCAGCTTCACTTCTTTCTCATCCGTGGCCACAATTAGCTTCCCGGTTTTCTTGTACGGGATCTTTTTTTCATCCAGATAAGCGTAGGCCAAATGCATGCCCTCCACGCAAAGGCGGGCTTTCAGGGTTCCAGGCTTATAGTAGATGCCAGCATGGATGACGCCGGAGTTGTGGCCGCTCTGGTGCTTTGCCAGCTTGCACTCCTTCTCCAGGACAGCCACTTTGAGGGATGGATGGCGCAGGACAATCTCCCGGGCAGATGCGGCGCCGACGATGCCACCACCAACGACAACCAGATCATAATCTCTGAGGGAATACAAAACATATCAGCTAACAGCCTCAAAAATTAAATAAACTTAAGACTTCTAAAGTTTTTAAAAGTTAGAAAGATGTTTGTATATCCGTTAGAGTAAAGAGTGTGCGGGCACGTTTTTGATTAGGATCATCAGTCAAGTCGATCTAGCCATATCAATATGTTCATCGACTGTCAGACCGC AGACCGCAAGAACGTCGAGATCTTGGGAACTAATAAGTAAGATAAAGGCTGCAGATTGCAGTGAAAAGACTATGCTATGCAATTAAGAATACAAAAGTAAATAGAATATACATTGCTTAACTAAACATGATTTTAAAAGCGCATTCTAAATGAAAAGAAGCTTACTTAGCTCATTTGGAACACCTAAATGATATTCTGCAAACAGTGAAAAGATTCTTAGGATCGGAACACCCCCGAAAATGAGAGAACCCTATCGTAATCTCAAGAGACTTACCCGCAGCTCGACGAGCTGTGCTGCGATCTTTTGTGGGTCGCTGTGGATTCGTTGGGCGCGGCCACGCCCACATTGAGTAGGCTACGCCGAAGTCCCTGTACCAGCAGTCGCACCTGAGCCATTTCTCTTTCTTTTATGCTTTCACCACCCGCGCACGCACGTAGAATTTAGATTATTTACCAACCCGAAAAGAAAGACCTTGCTTGACCTTGCCTTCTCCTCCGCCAACTTGTGCGTACAGCGCGCTTTCGAGCGAATCGACAGACTGAAGCCCGTGGAAGTTTTCCGTGGGGCGAGAGAAAATAAATATGCTCACGGGCCGAGCATCTGGGCGATTTGTGGGGCCGAGGGGCGATCATAAACGCGCTAATTGATAAGTGTGACGGATTATTTTTGAAAGGGGGTGGTTGGGTAAGGACGTGTGTGTCAGCTGTTCGGTTTGTTGATAAGATTTAATGTGCCCAGCTGCCATTTTGCAAATTTTCTGTAATCTAACAATATTAAAATTTTTATTTCATTTTAAATATTTCAGGTTATACGATCATGCTGATTACTCGACTAAAAAGTATTTACAAGAAACAAACATATAATTTTAACCCTAAATTTGCTTTTATTCGATACGGAATCCCATTATATTTGGTCGTATTTGATAGCAAACACAAATGAATAAAGTTTCGTTATTAATTCAGAACTGCAAGAAAAAAGACCGCTATCAACAATATGTGAGACGCATTTTCCAACACTGAACACTTCAGAAGCAAAACAAAACCAGCTGATTTAGCAAACAACAGCTAGCTCACAGATGTAAACAACAGAAATTTGCAAATTATTACAAATTATTGTACCATAAATACCTTAAGATGCCCGCCCACTGCGCCGTGATAAATTGCAGCCATAAGTATGTGCACGCG


Search Again