CR00037

CRIMIC CR00037

Gene Dsor1

CG15793

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 OK no bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
AATGGATGGGATTTGAAAGTGGG

Amplicon 5' Amplicon 3'
TGACCATTGGCCGCTTTAGTCGTAGGAGTGTATTAACGGTATTTGGTAATCGCGACATCTGGCCATACCGCACCGTCTGCGAAAAAAACCCAAAAGTCGCCGATTTTGGCTGATTATTGCAAAAATAATATTAACTATCCGTTTGCTGTTCGTGTGCTCGGTTCGGGTGTGTTAAAGTTAAGCGCAACGCGAGGAATTGGTGCAAATTTACCAGCGGCTGGACACACAAAACGAAACATTCGCACTTGGCCTCCCTTCGCACGCCCCCTCGCCGACGCCCCTCGCCCCTCACACCCTTCAGCCGTTCGTCGGACGCCGCTGTTCGTAGTGCGTTTTGTTGTTGTTTCCACTGGAACACTCTCTATTTGTATTGTTTCATTTATTAGTTTTTTTTTGTTGTTGTTATTGTTGTGTGCTTTAACTTATCGGTAACGGATAACGGTATCGAGAGATATATATTATATATAGTAAGATGTCGAAGAACAAGCTGAATCTGGTGCTGCCGCCGGTAAATACGGAGGCAACTGTTGCCGCCGCCACAGTGGCGCCGACGCCGCCATTCAAAACCCCCTCGGGCACAGAGTAAATATTATACATAATATCCTTAATAACTGACTGGTTTTTAGGCCACCCATTCCAATAACACCGCATCCCCCCTCCCTCGCTGTTTCCCCTTCCACTCCTCGTTTTCGGTTTCCTACTCAGTGGTAAGATAATCCTGTAGTTTTGCGAGTTAGGTGGGTAATTAATATCCATCAATTGATCCAAGGAAATCCCATCCAGCTGGAAAGAAAGAGACAGTCGGAGTGAAAGAGCAGGTACTCTCTCTTTGTTTGTTGGTGTGGGTGGTGCTCCTTTCGTGTGACGCACAGGTACACAGCGAGAAAAAACTTACTGAGTAAATACAGTAAACTGTTTTAGTGCTTTTTGGATTAATTAACGGGATGACAAAGTCAGTTTCGAAGATAAATAGAAATTATAATTTAATAGTCCTACCTTTATCGTATATTTTTTTGTGAGCACCAAAATGTAGGCAACATAACATAACACAATACATATGTAATTTGATGTGTATGTTTGTGTAGTTTTCTTATTATTAGGAGAAACTTCGGCCCGCCCCTCATCCCATCCCCCA TCCCCCACTTTCAAATCCCATCCATTGCTTGCACTTTTTACATTTTCGTTTTGGATCGCAAAAATTCATTAAGAGGTTAAATTAAAGCACACACAGTTTGCTGGGGAAGCCCAAGACGAGCATCGATGCGCTGACAGAGACGCTGGAGGGTCTGGACATGGGCGACACGGAACGCAAGCGGATCAAGATGTTCCTCAGCCAGAAGGAGAAGATCGGCGAGCTGTCCGACGAGGATCTGGAGAAGCTGGGCGAGCTCGGATCGGGCAATGGCGGCGTGGTGATGAAGGTCCGGCACACGCACACACACCTGATCATGGCCAGGAAACTGATCCATCTGGAGGTGAAGCCGGCGATCAAGAAACAGATCCTGCGCGAACTGAAAGTCCTGCACGAATGTAATTTCCCGCACATTGTCGGTTTCTACGGCGCCTTCTACAGCGACGGCGAGATCAGTATCTGCATGGAGTATATGGACGGTGGATCACTTGACCTGATCCTCAAGCGGGCCGGTCGAATACCAGAGTCCATTCTCGGCAGGATCACGCTGGCGGTGCTCAAGGGCTTGAGCTATCTGCGCGACAATCACGCCATCATCCACCGTGACGTGAAGCCGAGCAATATCCTCGTCAATAGCAGCGG


Search Again