CR00036

CRIMIC CR00036

Gene Itp-r83A

CG1063

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 OK OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
CCCAGGAGATCCATCACCTCCGG

Amplicon 5' Amplicon 3'
ATTTCAGGCGCCTTAACGGAAAATGTTTTGTGTGAAACAAAATAGGTTTTGAGAAATGTTGCTTGTTAAATAACCTAAATATAACCTAATATAACTCAAAAATGGATTATATTAAAAAAAAATAAGTTTCCCTAAAAAGACTATACTTACTATGAACTATGAACTCGGTTAATATTGAAAATATAAAGATATATAAAGATAAAGATACTACAGACGTGCAATTTTGTTACAGTTTTTATATTTAAATTTTCCGGTTACTGCTTTTATTTAAAACTCCAAGGAATCCAAAATTAAGCACATTACATAAATGGGCTAAGAAAAGGTCCAACTAATTCACTAATGGAATTGGATTATTTTTGAAACCATTAAGCGCTTAGGTCCATCATTCTAACTCTACGTGGTTTATTTTTCTATCCAACAGTAACGGTGCGTGTCGTCGCTAAGTGAACTGACGAGCTTTGTTTTCCCAATTCATATATTTATTATTCGAAAATGGCTTAATGGGCTAATATATTTTTTAAAAATATAACCATTTTTACAGTACACATATATGGCTAAAACATGCATTTATCGCACACTTTCATGTACGATAATCATACTGAGAGCGTTCTTTGTTTTTCCCCTAGATGTAAGCGAACTCACGTTGCTTTATCCTTTGCCAATCCCCGCAGGACATAACGAGGTCGACAAACCAGTGCAATTAACTCGCGTAGCCGACTGCGCCTCCAAACAATAGCTCCCAGCTCCGGAACAGCTACGGCCAGAGAGCACAGCAACAGGCGCTGGCACGTGGGGAGCATCGGGTGGAGGCCCATTGTTGCGCCACCTGGCGGCAGCCACTGTACACATTCGGCACTCTCGACTTGGATACCATTCCCATCGCAAGCCCCAACCCACAGTGGGCTTCAGACATGGGCGACAATATAATTGGCTCGGCAAGCTTCCTGCACTTGGGGGACATTGTGTCCCTCTATGCGGAGGGCAGCGTTTGCGGTTTCTTGAGCACACTCGGGTAAGTACCATTGTCCATGCTGAACGAGGACGCAACAAGT ATCTCCTGGGGCCACCTATTGTTGAATACTGCACTAAACATCTGGTTTCTTTCGCCAGCCTGGTCGATGATCGCACAGTGGTGTGTCCCGAGGCCGGAGATCTCAGCTGTCCGCCTAAGAAGTTCAGGGGTAAGATGGGATATCTTATAGTTGATTTTCACTATGTTTATGATAAAAATTTTCAGACTGCCTCATCAAAATATGCCCCATGAACCGCTATTCTGCGCAGAAGCAATTTTGGAAAGCAGCTAAGCAATCGGCCAGCTCCAATACGGATCCCAATCTCCTCAAGCGTTTGCATGTAAGTTCAAGAATAGTTATAATATTTAATCGTTTAAAAATGTATATTGTGTTTCACAGCATGCGGCGGAGATCGAGAAGAAACAAAACGAGACGGAGAACAAGAAGCTGCTGGGCACCTCAATCCAATATGGACGAGCTGTGGTGCAGCTACTGCATTTGAAGTCCAACAAATATTTAACAGTTAACAAGCGACTGCCGTCGCTGCTGGAGAAGAATGCCATGCGCGTTTATCTGGATGCCAACGGGAACGAGGGGTCGTGGTTCTACATCAAGCCCTTCTACAAGCTTCGCTCCATCGGCGACTACGTGGTTGTTGGTGACAAGGTTATTTTGAGTCCGGTGAATGCGGATCAACAGAATCTCCATGTGGCAGCCAACTACGAACTGCCCGACAATCCCGGCTGCAAGGAGGTCAACGTTCTGAACTCGTCGACCTCCTGGAAGATCTCGCTGTTCATGGAACACAAGGAGAACCAGGAGCACATTCTCAAGGGCGGAGACGTGGTGCGTCTATTCCATGCCGAGCAGGAAA


Search Again