CR00033

CRIMIC CR00033

Gene Hsc70-5

CG8542

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 OK short bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
TGCTTATCTGGACTTGTTGCCGG

Amplicon 5' Amplicon 3'
GCAGCACATTAAGACCAGCGATTTGACCAGCATCCTTGGTGGCCTGGCGTTGGGAGTCGTTGAAGTAGGCGGGCACGGTGACCACGGCGTTCTTCACGGGAGTGTTCAGGTATGCCTCAGCGGTTTCCTTCATCTTCATCAGGATGAAAGCACCGATTTGGGATGGAGAGTACACCTTGCCGTCGGTGGAAGAGACCCAGGCATCGCCATTTGAAGCCTTGACCACCTTGTAGGACAGGTTAGTGATGTCTTTCTTAACCTCGGGATCATCAAAACGTCTGCCAATCAGTCGCTTGGTGGCATAGAAGGTGTTGGCCGAGTTTGTCACTGCCTGGCGCTTGGCGGGCATGCCGACCAGCCGCTCACCGTCCTTGGTAAAGGCGACGTGGGAGGGTGTGGTCCGGGCTCCCTCGGCGTTTTCAATCACCTTGGCCTGCTTGCCCTCCATGACGGCCAGGCAGGAGTTGGTTGTTCCCAGATCGATTCCAATAACAGCACCTTTGACCTCACCGGACCTGGAAAGGGGGAGGGGGTGGGAGGTTTGTTTTACATATGGATAGAGTAGACTGATAAGGCCGCC GCCGGCAACAAGTCCAGATAAGCACCACGTTTCTGGCCACAGATATTTGCAATTATCAAGGCATTTTCTTTTAAATATCGTACATTATGATGCAACATGAGGTAGCTTTTGGAAATCTATCTTATGTTTGTCTAGTGCTTACATAATTGTGTTCCGGTAATAAGAGAAATTTGCGAAATTATAACTCGATTTCACTTACTTGTAACGCAGCTGGGACGATATTCCATTGCTAGCACCTGGCAGATTCTGTAAAGACAAAAAGGGGCTCCGCTGTAGAATCTTCCCGCAAAACATGAGACCGCATCATCGGCATGCCGCACTTTATATAATAGTCGTTGGGTCGGGGCGGGGGGATGGTACTTACGCGGAACATGCTAGAAGCTCCGGACATATGGGAGGGTACCACGCCGGCCTGGCGGGCGAGACGGGGCAGAAACTTGGGTACGCGCAGCATTTTGGCTTTTTACTTCTGCAATTTCACACGAACAATTGTCAAATTAAAAGCAAAAATTTCGTCAGAACGGCGGAGCACGTTTCTTCCCGTGAGAGGACTGTAAGGTAAGTGGTGGACTCGGGCTTGTCTCTGTGCGACGGGCAATGCGATAGTTTCCCGCAACTCGCGTGCCAGAGTTGTCAACGGTGTGAAAGTGTTTCTTCAACGAATTGTGGTGTATAAAACTTTAAATATTTCAATGGCCCTTCAGCACAAGGTGGTTTGAAAACATAGTAAATGAAAGCAAACTAGATGTAAAGTGAAAAGAAACAGCAAAATTTTATATTCAAAGATTAGTTCGGATAAAATATTGTTTACTTTCTTAATTTTAATAAGATATTTATTTCATTAAAGTTATAAACTAAACAAGTGGCATCTAAATAAATAGCAATTGCAACACATTTAACATTTGTGATTTCCGATTAACCTACATATTTTTTACCACTGGTGTCGCTGTTGTAGTGAGACCGTACATCCGCAGTATGACCGTATCTCAAAACAAAACCCAGTTGGAGCAAACCA


Search Again