CR00031

CRIMIC CR00031

Gene CG7358

CG7358

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 no band short band79227

Images

Construct Sequences

sgRNA sequence
CCATAAACATTAATGAGAAAAGG

Amplicon 5' Amplicon 3'
GGGGAAATCCGCGTGAGTAACCACCAGGCGGTTGCACCGGCAACGTCATCAGCGGTGGCGGATGCGATCGGTAACCGGGCCGCTCGCCGTGATCGCCATGACCGTGGCCTCCGCGCCGGAATCCTCTGCCGGATCCTCGTTCGCCCCTCGGATGCACATGGTGGTGCGGTGAAGCTGGATGCGGATGCGATGGTGCTGGCGGCGCGTCATCGTTATCCCGCCAATCACCTCCAGAATTGGACGACTGCTGTTGCCAGCCGCGTGGCTTTTCCCGCTGATCGTGCTCCAACCAAGCGGGCTCGTTTTTGATAGATGGCCTATCGCCGCCAGCGCCTCCGCCTCCTGTGTCCGGTCGATCCTCACGATCGCGTTCGCGTTCCCGATCGCGCTCTCGTTCCCGCTCTCGCTCCCGCTCGTCCGCATCCCAGTCGGGCTCCGAAGCAGAATGGTGCTGCTGCTGCGAGGGAGGTCCTCCGCCCGCATGAGCTGGGGGTTTGCCCCGCTTGGGTCCGCCAACAAAGCCACCCGGTCGCCCAGGGGTTCCACTAGGTCCGCCTGGGCCGCCACCAGCTCCCTCCTCCTCCCACTCGCGTTCCCACTCCGGTCGGAAGTCGCCACGGGGTCCAATATTACGTTCCCTTTCGCGGTCACGTTCTCGTTCCCGATCACGCTCCCTGTCCCGGATTAGACGTTCCCGCTCGTCCGGATAGAGGGTGTCTTCCGTTTCGAGGTCACGGTACTCGCGTCCTTGCAGCTCTCGTTCCCGCAACTCGCGTGCCTCCAGCCAGGCTTCTCGTTCCCGCGAGGAATAGCGGGCATCTAGATAGGCGCGTTTGTAGGCTCTAAAATAAGGAATTCCCAAACAGCGGATTAGCTAATGCCGATTTCGTGG AGGTTCCCGTTCTGCTACCTAGTTAACTATGTTCTAGGTAACAGAAAAAAGTAACCAAAATGGTACAGTTTCAGCTTTTCGTGGAATAGTTAAGTGCAGAACCTAAACCTACCTCTCCCGCTCCTCCTCGGAGTACAGTTCCCGCGGATCCCGCAGTCTGGGTGCATAATGCTCAGGCATGGGACTGAGGTCCCTGCGCCGATACCTTCGCATCTCGTCGATCAGCCCGTGGCCGTGTCGTTCCTCCAGATACTCTTGCTCACGCTCGTAGGGATCCAACTCGCGCTTATCGCGGACATGACGCCCGCTCCGTTCGCGCTCTCGTTCCCTTTCGACGGTGTCCAGCGATCGCTCCCGGCTGCCATACGGCGGAAGATCCAAGTCTCGACCGGGACCACCGCGTTTACCACCTTCCTCTTCCTCCTGACGACGCAACTTTTCGCGAGCCAAGCGTTCCCGCTCCCGTTGACGTTCTTGGCAGCGAGCCAAGGCCTCAGCGCGCTCCTTATCCCTGGCTGCCTCCCGTTCCGCACGCTCGCGCTCCCGATCCCGACGATCTCGCTCCCGCAATGAGAGATCGTG


Search Again