CR00030

CRIMIC CR00030

Gene Dhap-at

CG4625

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 OK short bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
GAAAAGTGGCGTAAAATTAGCGG

Amplicon 5' Amplicon 3'
CACATCCGCCTTAATGCTGCTCGGAGTCGTGCTAACATGGGCGCCCAGCTGCTCGAAGATTCGCTTCAGATGCAGAACACCTCGTGCTAGCTCGTCCAGAGTGACACTCCTTTGGGCATACAATTGACTGGCGTAGTAGAGGCTAAGCAGATTGAACGTGGAGATCACAATGCGACGCTGCTGCTGGTAGATAATCTCATTGGCCAGCTGTTTGACTAGTTCCACCTCCTGGCGGTTCAGCTTCTGCAAGTGACCACCCACGCCTGCTCGCTGCATTCGCTGCGCGCTGTCGTGTCCGAAAAACTCCTTGACCGAGATGGGCTCTCCGAAGTCGAGGAACATCTTGCCAAATCGCTCGTCGATGATTTTTAGGGCCTTGAAAAAGCCCTTTGTCGACTCCTTGGGCTTGGGCACACCCAGCAGCTCATAGACGAACAGTTGCTCCTCCAGGACGCGTTCGTAGGCCACACTCACTGGCACAATCATCACATCCGGCACTTCGCCCGTGAAATATGGCAACAGAGCCATCGAGAGTAGTCCAATTTTGGGAACCAGAGCTTTGAAATTCCTGGAGCGCGTGCCCTCAATGAAGAACTCCACGCCGATGTGGTAGTTTGCCACCAGCGCGTACATATACTCCCGGAAAATATCCCAGTATAGCTCATCGTTGGAGAAGCTGCGGCGCATGAAGAACGCTCCTGTTTTCCTCAACATGGTGCCCATTCCGAACATGGAGTGGAAATCTATAAAAATTAAGTAGACAACAATTAATATTATTGGGCAATTAAGAATATTAACGACTTTTGTTTAGAAACAGCGTACAAAAATTAGCAAATCCGTTGACAGTCAC AAAGTGGCGTAAAATTAGCGGAAAATATAAGCTCGCTTAATGTATTTAACACATTTTCCGCCAGATTGTAATTTGTTTATGGTTTTTGGCGAAACATACCCATGCCGGCTGCTATTCCTGGTATCTCGATGTCGTAGTAATAGCAGATGTAGGACATCAGGATGAAGTCCATGTAGCTGCGATGACTTGGCAGATAGAGCACCGGGCACTTGCCCATATCCTTGCGCACATTGGCCATGCTAGCCGAATTGACATAGAATCCATCGCAGATCCGCTTGCCGATCGCCGTAATGGCAATGCCGCACCACCGGATGATGGCCATATTCCGATCGAGGCCGATTTCATCAATGATCGCCCGGGCCTGACGCTCCATCTGCTTGAGCGGCGTGCCCGACTCCTTGGCATAGTGCTCCAGAATGGATCGCAGCTTCTCGCTCCTAAGGACGTGCTGCTTGAGCTTTTGCGGATTGAGATACTTTTCGAATTCGTATGCCACCTGCGGATTGAACTCCCTGGTCATGGAGGCCTCGTTGCCCGGCGCTATGATGTTCTTGAAGTTCCTCATATATTCGGCCGCACTGGGCGTCTTCTGCTCCTCCTGTTCGCTGGATTCACCTTCTACGGTGCCGGATGACGTCGACTGCCTCACGGGATTTCTATCCATCGCGCTGCGCTTCAACTGTGGAAATGGAAAAAAAAAAACGTGCGTCGGTCCGATGAGAATCTCTGGAGGTAGCTGACTGAAAGAAAATATTTGACGAATCAACTGTCAAGCAGGCGGCCCCACTTAACAGACATGACACACAAACACACTGCCATAAACTCGCTGTTTGCTGAGATATCGCAGGCACTGGGAGAAAATGTGTGCAACGAAATGTCGGAGTAAAAGATATATATATTTTTAATTTGTTAAATGTGCCATTTAAGTGTATATTAACTTTTTAAACACTTATTAAAAATTAATTTAACTTTCAAATTTGTATAATTTATAAAAAGAATTTAATTTAAATTTTGAAATATGCAGTGCATATCGAGTTTTATGTCTGATAGGTTATAGGTTCATTGCGCCAAGTGATCGTTTGTGTGAAGAGTGCCTTGCTATCCCAAAGGTTGATTATCTGACAGATTCATAAGCAGTTACGGCAATCAGCGGCGAGTGGCGAATGTTGCGTGTTAAAGGTGAAGGCG


Search Again