CR00029

CRIMIC CR00029

Gene Psn

CG18803

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 failed reaction failed reactionOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
TCTAGCAAATGACTCTCAAATGG

Amplicon 5' Amplicon 3'
TCCGGATGGGCAAGAAGAACGTAAATATACTATATACATATAGAAGTGTGTAAACCATAAGCGATTCCTGATGAACGATTTTATGTAGGTGGCATAAAGCTTGGCCTCGGCGACTTCATCTTCTACTCGGTATTAGTGGGCAAGGCCTCCAGCTACGGCGACTGGACGACCACAATCGCTTGCTTTGTGGCCATCCTCATTGGACTCTGCCTCACTCTTCTGCTTCTGGCCATTTGGCGCAAGGCGCTACCCGCCCTGCCCATCTCAATAACGTTCGGATTGATATTTTGCTTCGCCACTAGTGCGGTGGTCAAGCCGTTCATGGAGGATCTATCGGCCAAGCAGGTGTTTATATAAACTTGAAAAGACAAGGACACATCAAGTGTCTTACAGTATCATAGTCTAACAAAGCTTTTTGTAATCCAATTCTTTATTTAACAAAATGCATAGTAACAACCTCGACTAATTATTGCTTGCGCTTAATGATCGTTTTGTCCACTATGTTGATCAGCCAGCCGGGTTCCAGGCCGTAGAATACTTGCCTTGGATCCTTCGCTGTGGTGAGCATCTCGTACGCGGAATCTTCCTCAATTTTGGGCAGCTGATAGCCGTACTTCTGGGCCAGAACTAGGCGGTCCTGGCTGATCGCCTCGGGATTGGCCAGGTAGCCGCGATTCTTGGGATCCGTATAGTAGTCCACTGCATCCTGGGGCGGCAGCATGCGGCTAGGAATAGGTACTCCCTTTTCGAACCACTTCTTCGGATTGGCCAGCATGTGAAGGCTGCGTGGATCGTAATAGGCCGTACGGATTACACCGCCGTTCTTCTCTATGGCCGCTATGACCGCCTCGCTGGCGTGCTGCACCTCAATGTTGATCTTAGCCTGGAAATTGTCCAGCCCATCGTCCGTCAGCTGGAAACCGTACTCCATTTCAGCGGGTTTCAGTTTCAGGAGGCCAGAGTTACACAGCGTGCT CTGGCTGATGTCTATGCGGTTCGTGTCGATGAGCACTTGCAGTTGGAGCAGCGAAATGGGCGGATACTGGCGCTTTAGGTGGTGTCCCTTGTAGTAGGGCTCGTAGGGAAATCTCAAGTAGAAGGGCTGATTGCCCGTTTCATAGCCCAATCGCATGAAGTTCTGCCGCTGACCGGATCCCTTGTTGCCCGCTCCGTGCTTATCTCCTCCGTGTTGTGCCCTGCCGCGCTTGTCCTGCCGAGAAAATAAGCAATATATTTGTTAATAGTTTATTGACGACTGCATGCTGTTATTCAACCACTCACATTCTGTTTTGAGTTTGGATTTGGTCGCAGATTGCCGATTTGAACGCGCGGTAAAGTACGCAACAGCTTCAGCGCCTTGTCCGAGGTCTCCCGCAGGTGTGCCATACCGAAGTTAACTTAATTTATTTAATAAAATTATGTTTATCGGGTGAAAAATAAAATTTACACGAGAGTAAGTATGTAAGTAAGACCGCAGTTGGTCGGCTAACAAATACCAACCGGCTTATAAAATATACCAACTTTTAGGTCTGTGCTTCAGCTATGCGGTATTCAGGTTAGCTGCGACCACACTGCTCTGCCGACGCGCAAAAGCAAACCAAAACTTTATCAAATAAAATCCATTTATACATAGATCTCTTCATTAAAATAGTAAAATTTTATTAAGTTGTAAAAAAGATGACGTGCGGAAAATGTCGCGGTCACAAGGAAAGGAGCGTGAAGTGCCTTTTAGCCGCTTTGGACACAATCAAAGAGCACGCCTTAAGTAAGCCAAATATATTTATATTTACTCATTTAATTTAACATGTTCCACTTTTTAAAGTGATGCAACGAGACTCAGAGGAAAGTTCGAGGACCATAGAACAGCTAAAGATCCACAATGAAAAGCTGCACAAGGCCTTGGACTTGCTGAAGGAGCGGCAGGCATCCTTGGTCCAGGCGGAGAAGCGCAGGAAGCTGTTGCCCACGAAGATCAAGGATGACATATCGCCGCAGACACAAAGCCAAAACTCCCTTAACATGAACATAGCCATTAGCAACATAGATCTATCCGACGAGGACCAGG


Search Again