CR00027

CRIMIC CR00027

Gene Idh3a

CG12233

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 OK no bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
TGGTTTGCAGGGTTGGTTAGCGG

Amplicon 5' Amplicon 3'
ACCACTAACTCTGGCTGGGATTACGACACTTACCCGGACGGGGGTCACGTCCACGGCCTCCCACTCGATGGGGACATTGGCGGCGGTGAAGATTTTCTGCACGGCCGCAGAGATCTCAGGTCCGATGCCATCGCCAGGGATGAGGGTGACTTTCTTGGTGCCGGAGGAGTAGGACCGGCTGGCGGCGGGAGTCGCGTTGACCTGGAAAATAGCAAGACCATAGGCGGGTTACAGAGTGATCTACAGAAATGGTGGCGAGAAAACGCATAGATGGGCAGCAGCAACAGCAGCAGCATCTAGCGGGATTACATAAGTGCCCATGCCAAACAAAAATCCCGTCCGCCCTACCCCCCGTGCCAAACAGTTCGTCGCGTTGAGGTTAGAGTGCACAAATGATTCCCACGGCGCTGATAAGGCCGCAAATCAGGGCCCAATCTCGGTAACTGATTTTTTCCCGCCTCTCGAGTAGGGGGTGGGATTTTCGAGGGTCCGAACCACCCGCCCTGCCCGCCGTTATCGATATCTCGGCCACGCAACGAGGGAGCGAGAGAGAGAGTGTTATGTAAAGTGAATGCGAATTCTAATGCTGTGCTCTTTTCGTTTTCGCCGGACGGACAGCTGATGTCCTGGCGAAGGAGGTGGTGGCCCCCACTGCGGATCCCGGATGGTTCCGTCGCTGCCGCCGCTGTTATGGAACCAACCTGGCTCACTGCTGGCGTCGCAGTCACCGCCGGAGCATCACGCGCTGCAATCAAACCCAGTTGATTGAGCTGCAAGTGTTTTGCGTAATGTGTTGTTGTCGTTGGGAATCGCGGAATCGCAGATCATTGCATCGGTGG GAGCGTCGGACGAGAAACAAAATCGCAATGTTAGTGGTAGTTGGCCAGTACTTTTTGGCCAGCACGTAATCAACTGCTGTCCTGCAGAATTGGTTTGGTCGCTGTATGGTGGGGTTAAGAGGCGCGACGCGGGGCGGGTCAAGTCGCTTAAGCCTAAACGGGTCTTACAATTTTCTGTATGAATCTAGCAGCCATTGCGTTGGATCGGTTTTTGCACTGATTCCTGCCGTATATTATATAGAAAAAAGTCTGTCTTTTTAGTCTGCGCCCGCCGTAGTCGCCACCTTGCGGAAAACTGGCGAATCTGCGGTATATCGGTCGATAGGCATGCGGGGGCAGCGTCGTTGCCACCTGGACTGCGCTCAGATGGGGGTGGAATTACAAATCACCCATATCCCCGTATTTGTATGCTCTCGCTTGCATCAGTCACATAATTGCTGTACGAGCATCATATGTATGGCGTAAAACCACATTAAAGTTGGCTGTGAATAAACAGATGTCGAATATCGATGTCGTCTGCCCGAAATTCAGTACAGCCTGCCGTGTGGCATCCCTGTACAGGGCAAAAGCGAAATATCGGAGCGGCCTAATCGATAGTTTGTGTATCCCTTGCAACCGTGGCTGCTACAGCCACAGTTTAAATTAATTTGAGCATTCGCTCAGTTTTCTGACGTATATTCTAGAAAAAGTGCTGAGAGTGTCCATCAAAAAGGGGCAAGCGAAGCCGTTTCTCGATCTCCAACGAAAACGGGGATAGGATAATCCAAGGGGCCGCCTGTCGAGAAGCCAGGCGAGGGCAAAAAATCGGATCAACCGACAGACAAAGCTGAACTGCGGTCGTCGGCGACAAAGTGCGCTGTGCCCACGGACGACCAGAGAGAATCG


Search Again